Transcript Name :
Sapdi_VS20SDRG_00054
Orientation:
(+)
Number of Exons:
2
Description :
TKL protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Serine-threonine/tyrosine-protein kinase catalytic domain5PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain5PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain5PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain5PR00109
Profile scan predictionP-Valprediction_id
Protein kinase domain34.888PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4.7SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-231
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        752 bases(100 bases per row)
ATGCGCGTTGCAGTCAAGTCGCTCTACAAGAAGGGTAACTACATGGATACGTTCAAGAAGGAAGTCGAGCTCATGCACCGCCTCGAGTCGCCACATACAC
CCAAGCTCCTTGGCATTTCCAGCGACAAGGATGGGCAGCCGTGCATCGTCATGGAGCTCCTGCCCGGCGGTGACTTGAAAGAACATCTCGAGCGATTGCG
TCAACAGCTCTCAGCGACTCACACCGTCGAAAGTATGCTCCCGTTCGCTCTTCAGATCGCCAAGGGTCTCGCCTACCTCCACGGACACAAGATCATCCAC
CGCGATCTCAAGCCAAACAACATCCTCCTCAGCAACGATAAGACAACTGTCAAGATCGGCGACTTTGGCGTTTCGCGCCAAGCGAGCATCGAAGCCATGA
CCAATAACGTTGGCACCGCGCTGTGGATGGCCCCCGAGGTCGTGCTCACCCGCAAATACTCGATTGCAGCAGATGTTTTTGCGCTTGGGGTCATCTTGAC
ACAGCTCAATACGCTGCAGACGGACCCCTACGCTGATCGCAAACTCAAAGGGATGGCGCTCGTCTTCAACATCGCTAAAGAAGGTCTGCGCCCTTCGATG
CCGTCGACGTGTCCCGTCTGGTACCGAGACCTCGCGACGGCTTGCATGAGCGCCAAACCGAGCCAGCGTCCTACTGCTGCTGAGGTCGTGCAACAACTCG
AGGCGCACTTGGCTCTGCCACAGCTTCCCGACCCGGGCCTTCTCGATCGTGA