Transcript Name :
Sapdi_VS20SDRG_00034
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Thaumatin8.522PS51367
HmmSmart predictionP-Valprediction_id
Thaumatin0.0014SM00205
Apple domain1.4SM00223
Apple domain0.078SM00223
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
ThaumatinIPR001938
Y-scoreD-scoreY-pos
0.6420.71821
InsideOutsideTMhelix
1-427
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
extracellular regionGO:0005576IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1389 bases(100 bases per row)
ATGAAGATGTTCTCGTCCTACGCTGTACTGGCGGCCGCTGGCCTGTATGCGGTGAACGCGGCCGAGTTTGTCTTCAACAACAAGTGCCCTTATACCATCA
ACCTCCACGCCGCCCACGGCAAGCACCTCTGTGACATCGCGCCCGGCCAAACACGCGACAAGAGCTGCGGCGTCACGATCACGACCAACGCGCCCGGCAT
CTTTCGCCACACGGCGTCCGACCAAGTCAACCGTACGTCGTCTTGTCGCCGCTCGGTGGGCCTCATCTTTTTGCCTTATGTGTAGTCATCGAGTATGTGC
TCAACGGGCAGCTGTGGTATGACTTCAGCAACATCCCGCCCATGGTACTGAGGACGATCTGCAGCATTGCATATTCTATCTCATGCGATAAACTAGCCGG
GCAATTGCAACAGCTTCCAAGACTGCAAGGCCAAGACCAAGGCCGTCGGCTTCAACGTGCCCATGTCGCTCACGCCGAGGAAGAAAGCTGGCACAAACTA
CAGTCCCAGCTGCGTTGCGCTTCTCGATCTCAAGGAGGACGCTCCGGACGCCTACCTCTTCCCCGCCGACATCAAGACGCACGACTGCCCCGGCGACATG
GTTTTCGATGTTGTCTTTTGCCCTGGCGGGTCGGCCCCCGCTTCAGGCCCCGCTCCAGCCCCCGCTTCGGCCCCCGCTTCGGCCCCCGCCCCGACCTTGG
ACACGTGCACGACGCAGATGGATGTCGACTACCCGGGCAACGACATTGCCAACAGTCCGGTGACGGGCGACCGCAACACGCAGGTCGGTCAGTGCTGCGC
CAAGTGCTCAAGCACAACCAACTGCGTGGCCTTCACAGTCGGCTACAACACGTGTTACATGAAGTCGTCGAAAGGCAGCCCGCGGCCCGCGACCGGCCTC
GTTTCGGGCTCCCCGGGAGCTGCACCGCAGCCGTCGGGGACGTGCACGGCGCAGATGGGTATTGACTTTACGAGTAGCGGCACCAACAACGACATTGGGA
GTGCCCCGGTCTCGGGCTCGACGACGGACCAGCTCGCGCAGTGCTGTGCTTTGTGCTACAAGAACGACAAGTGCGTCGCGTACTCGGTCGGGTACGGCTC
GTGCTACATGAAGTCGAGCGTCGGCGTGCCGCGTGCCAACTCGCAGGTGTCGTCCGGCATCAAGGGCGCAGGTCCGTCGATCCAGTGGAAGCAGGACTAC
TGGGGCAACGACATCCTTGGCCTTGATATGCCCGGGTCGGCCATCGACCAAGCGACCATGTGCCACAGCCTCTGCAAGACGACGGCCAACTGCGCCGGCT
TCACCATGAACGGTGGTCGCTGCTACCTCAAGCACCAACTTGCCAACGGCTACAAGAGCGACACGGCGTACTCGGGCACCAAGAACTAG