Transcript Name :
Sapdi_VS20SDRG_00004
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-49
99-124
185-228
289-319
410-415
460-465
526-554
630-641
73-75
148-161
252-265
343-386
439-441
489-502
578-606
665-679
50-72
76-98
125-147
162-184
229-251
266-288
320-342
387-409
416-438
442-459
466-488
503-525
555-577
607-629
642-664
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2119 bases(100 bases per row)
CTCTGCCCCACAGCCACATCGAGTCGAATGCGGTCCGCGCAGAACAGCGTCGTGTCCGAGTACAAGGTCGCGGCGACGCCCCACTGGAACGAAAACGCCG
ACGATGCTGTCGCCAACGAAGCCAAGCACGCGGCCGAGTTTGAAGTCATCACGTCGGGGCTCGAGCACCCGCAGGTGACGATCAAGTCGCTCGTCGTCGG
CACCATCATGGGCACGTTCACGAGCGTCCTCGCCATGTACTATAGCCTCAAGCTCGGCGTCACGCCGTCCCTCAACGTGCTCTCCGGCATCGGTGGTTTC
ATGCTCTGCCGCGCCTTGATGAAGACGCAGTTCTTTGGCAAGCACTTTACCGTCCAGGAGAACGTCGTCATCCAGACGTGCGCGGTGGCGTGCATGAGTT
TGGCGAGCCAGGCCGGTTTTGGCTCTGGCATCCTCGGCCTCACGGAAAATGTCTTCCTCGTCATGGGCAACACGACGTACGCGGGCAACCTCGCCTCGGA
CGTCATCGACTTTACGTGGCTCCGCTCGTTTGGGTGGTGCGCGAGCATTGCGCTCTTTGGCTTCTTCATCTCGTTCCCGCTCCGCCGCAAGTTTATCATC
GAGATGCGCCTCCTCTTCCCGAGCGGTACGGCCACCGCCGTCATGATCAAGACGCTCCACACGTCGAAGGAGGCTGTCGAGTACCAATGGAACGTGCTCC
TCAAGTCCGGTGTGTTTGCGTACGTCTGGAGCATCTTTGTGTTCTGCTTCAACGGGCTCGGCGAGTTCCCGATCTTTGGCGAGAAGGCCGCGGGCTTTAC
GTGGATCCTCGACTTTGCGCCCGGCACCTTTGCCATCAGCTTGATGCTGCCGTTCCGCGTCATGTACTCGATGTTCCTCGGCAACATCATCACGTGGGGC
ATCCTCATGCCGGTGCTCAAGGCACAGAAACTCGGCGTCTGGTACGAGAGCGAAGGCGCGGCGGGTCTCAAGGCCTACTACACGTTCACGGCCGTCGCCA
TCATCTGCGTCGACGCGCTTTACAGCATCATCAAGATGGGTATCATCATCGGCAAGTCGTGGTCGGCCAAGAAGGACGAGAACAAGACGATCACCGAGGC
GGACGACAAGGCGACCGAAAACGACGACGTGCTCTCCAAGGCCCAGCGCCAGGCGTATCTCGACAAGATCTTCGAGTCGGCGCACATCCCGACGTGGTCC
TGGATCGGTGGCCTCGTGGTCTTTGCCGCCGTCTCGGTCGTCGTCATCTCGTTCATGTTTGAGACCGTCAAGTGGTACAAGGTGCTCGTGTGCTGCCTCC
TCATCCCGATCTTTGCGATCGGCATCGTCCAGGGCACGGGTATGACCGACTGGAACGTCTCCAGCGCTGTCGGCAAGCTCATCCTCTTTGTCATTGGCTC
ATGGACCGACGGCAACGACAAGTCGATCATCGCGTCGCTCATTCTGTGCCAGATGGTCATTGTCGGCTGCTCGCAGGCCGCCGACCTCATGCAGGACTTC
AAGACCGGCTACCTTGTCGGCGCGTCGGCCAAGTCTATGATCGTGGCGCAGATCTTTGGCGCGTGCATGTCCTGCCTCGTTGTCCCAACCGTCTGGGTGC
TCATGAACGACGCGTACACGCTGCCCGGCCCGCTCCTCAAGGCGCCATTCGGCGAGGTCTACCGCGTCATGGCGATCACGGCTACCGTCGGTCTCTCGGG
CCTCCCCACGTACTGTGGCTACTTCATGCTTGTCGGCGTTGTCTACACGATCGTGTTCAACTTGTACATCGACAACTTTTCCGAGTCCAAGAACAAGGTG
CTCAACGTCATCGCCAACCACTGCCCGCTCCCGATGGCCGTCTCGATCGGCATGATCGTGCCCGCGAGCTTCGGTCTCGAAGGCATGATCATGGCCGGTA
TCATCGCGTACTGGAAGTCCAAGGACGAAGCCTCGTTCGAGAAGACGCAGTACATTCTTGCCGCCGGCCTGATGACCGGCGAAGGTTTCTCGGTCCTCAC
GCAGATCATCGTGACGCTCTGCGGCGGCAGCGCGCCTGTCCAGGTGTCGTACGCCATGACGCCGTAAATTCACCCTTGTAATCGTGTCGTGTATATAACC
AAACAACCAAGTTTGCATA