Transcript Name :
Sapdi_VS20SDRG_00042
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain20.246PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
InsideOutsideTMhelix
1-6
76-81
166-171
279-284
345-350
464-474
30-52
105-142
195-255
308-321
374-440
7-29
53-75
82-104
143-165
172-194
256-278
285-307
322-344
351-373
441-463
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1645 bases(100 bases per row)
ACGACGACGACGACGCTCGCGACCAGAAGCATGGCAGGCATGGCGGCGACGTCGTGGATCTTCCTCCTCTTCTGCGTCATCAACATGCTCAACTACGTCG
ACCGCGGGATCATCCCGGGCGCGCCGACGCAGTTCCAGTACTTCATCGAGGCCACGCTGCACATCTCGGTGACGCAGGAGGGCTTCTACCTCGGGCTGCT
CGCCTCGTCCTTCATTGCGAGCTACGCCGTCTTCATCGTGCTCTTCGGGTACCTCTCGATCTTCATGAAGCCCTTCCGCCTCATCGCGATCGGCCTCTTT
GTGTGGTGCATCGCCATGGCCATGTGCGGCCTCGCCAAGACGTACCAGAGCTTCGCGCTCCTCCTCGCCGGGCGTATCCTCAGCGGCATTGGTGAGTCGT
CCTTCCAGTGCATTGCGCCGCCGTTCATCGACGACCACGCGCCGCCCTCGACGCGGACGCTGTGGATGGGCGTCTTCTTCACGCTCACGTCGGTACGCGA
TAGCCGCATAATCGCTCTCACTCAATCGCATACATGGCTAGGCGGGCACCGCGCTCGGGTACGCCTACGGCGCGGTCATGTCCAACTCGTCGTGGGGCTG
GGGCTGGGCGTACTACCTCGAAGCGCTCGCGATGCTGCCGCTCGCTTACATTTGCCTCGTGGGCATTCCGCCGGCGTACGACCAGCCCGCGAACGCGACG
GCCGAGCACCACCTCAAGCTCGACGAAGAGCAAGGCAAGACGCTACTGCAAAAGGAGGCCGAGTCGCCGCGGCTGTCGTTCTGGCAAGAATCGTACGAAG
TCATGGTCCACCCGGTGTTCCTCCTGAGCGTACTCGGGTCGGCAGCCTTCACCTTTTCGATCTCGGGCCTCGGCGTCTTTGGCCCGCTCTTCCTCATCGG
GCTCGGTGTGTTTGAGCACGAGACCGAAGCCTCGATGGTCTTTGGCGCCCTAGTCGGTACGTCCTTACTCTTTCTAAAGTGCAATCTCAGACAGGCGGTA
TCCTTGTGGGTAGTGGTGAGCGCGGTCGTCGGCACGCCGCTCGGTGGGTACCTTCTCGACCTCTCGTCGCATCAAGTGCACGCGACCGTGCGCCAGTACT
ATGCGCTGCGGCAGATGTTCCTCCTCATGGCCATCGGGACCGGCCTCGCGATCCTTGCGTGGTACGGACTCCCGTCCAAGATGTGGTTCCTCTCGCTCGT
GGGCCTCGCCCTCATCTTTCTGTTTGCGACGCCGTCCTGTACCGCCATTGCCGTCCTCCTCTGCGTCGAGCCGTCGCGACGACCGCTGGCGGTCGCTGTC
AATACGCTCCTTATCCACGCGCTCGGCGATGTACCGTCGCCGATCATTCTCGGCTGGCTCAAGGACAAGTACGCGCCCAACTGCGGCAGCATCGAGGTCG
ACGGCGCCATTGTGCTCAACCCGCGCTGCAGGTACCTCTCTCGCCGAGCGATAAGTTCTTAGCATTTGAATGCCTAGCGATGACGCGGAAGGGCTCTTGC
TCACGTTTCTCTTTCCGCTGCTCTGGATGCTCTGGACGGTCCTTGCGTGGGGCATTGCGGTCGTCGTCGTTCGCTGCCGCCTCGTGCGCGAAGGCCACTC
GTTTTAGCGAGGAACTAGACAAGTCAGCAATAGTAGTTCTATAAA