Transcript Name :
Sapdi_VS20SDRG_00012
Orientation:
(-)
Number of Exons:
9
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Leucine-rich repeat5.394PS51450
Leucine-rich repeat5.394PS51450
Leucine-rich repeat7.412PS51450
Leucine-rich repeat7.412PS51450
Leucine-rich repeat5.51PS51450
Leucine-rich repeat5.51PS51450
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, typical subtype74SM00369
Leucine-rich repeat, typical subtype74SM00369
Leucine-rich repeat, typical subtype1.5SM00369
Leucine-rich repeat, typical subtype1.5SM00369
Leucine-rich repeat, typical subtype290SM00369
Leucine-rich repeat, typical subtype290SM00369
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, typical subtypeIPR003591
*** None ***
InsideOutsideTMhelix
1-319
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1494 bases(100 bases per row)
GTTTGCACCAAATTTGTCGGAAACCGTCAATCGCAGATCGAAAGGTCGTGCATGGCGGACCTTCTGGGTAAGCTCGAAGAGGCCAAGCAGACGGGGCTGC
TGCACCTCGTGCAGCTCAACCTGCGCGCTGTGCCGAGTGACCTCTTCCGCCTCAACTTTTCGGCCTTGTACCGGTTGGATCTTGGCTTCAACCACGTTCG
CGTCCTCCCAGACGCGATCGGGCAGCTCGCTGCGCTCGAATTTCTTTGGCTCAACGACAACCCGTTGCAGTCGATCCCACCTTCGATCCACAAGTGCGTT
AAGCTGCAGGTCCTCGACCTCAATCGCACTGAGCTGCGCGACTTGCCGTGCGAGCTCGGCCGCATGCAGCACCTCATCGTCCTGGACCTTGACCGCGTCC
CGCTGGCCGCCAAGCTGCTTGCTGCGACGCAGGTCGTTGGCAAGAGCGAGAAGCAGGCGCAAGCCGTGTGCGCGAGCGTGCTGCGCTATCTACATCGAAA
GGACGTCCGGCGCCAGCAAAAGCAAATTCTGTTTGAAAAACTCAAAGACGGGGTACGCCTTCTACTGCGTGTGCAACCACTGAAAATGGCGTGGAAATAG
CCGTACCGCGAAAGCGCCGATACGAACGACGGCATGGAGCGCATTCACCGCCTCATGAAGCGCGCGATCAAAGAGTTTCCGACCGAAGACGACGTCCAGA
GTCTGATCCGCAACCTGGAGCGTCTATTTCCACCCAACTTGATCACGGCCAGCGACCACCCTTCGGCGACAGCGACCGCGATGCGCGCGCACTTTGTACA
GCTCAAGCAAGACAACCAGAAGAAGAAACTGGCGGCCGAGCTTGAGCTCAAGATCCGCAACATTTACTTTGACCGGATCGATCCCGTGGCCGTCGAGCCC
ATGGTGCTGGTATGCCTCTACAAATTTGCAAATGGCATCATACGGTTGCGTGTGAATAGTCGATCTACACAGAGATCAAGTCGCTCAAGGACATCAAATT
TCTCATTCGATATGCCACAAGCTTGTTCCCGCCGACCGCAGCCGAAGTCGACGGCGCCGAGCTTCGCGATCGGCTCGCCGCTCTTCAAGACGAAATGGCC
CGGTACTGAATACGGCAATTCTCCGAGTGGGAACGTATGTGCTGTAGCGAGCGGCAAAATGCCATCGACAAGGTGTTTGTGGCCGTCACGGGTATCTACA
GCGACGTCGAGCCCGACAAGATCCGCGCGCTCATTGACCAAGTCGTACCGCTCTTCAAGGTCGCCTTATTCCCGTATGTAGTACATTTGGCAACGTCAAA
GTAGAACGTCAAAGACCTCAAGACCTTGGCCGCGGACGCCGCGCTGCACTTTCCAAGCGAATTCCTCAACGCGGTCGCTGCCGACATCAAGCAGAGCTTT
GTTCGCAAAGCCCACGGCGCCGCCGATATGGACAAGACCCTTTCAATGACCAAAACGTGATCGAGTAAAAGCATAATACGACTCGTTTAACGCA