Transcript Name :
Sapdi_VS20SDRG_00056
Orientation:
(+)
Number of Exons:
1
Description :
TKL protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Serine-threonine/tyrosine-protein kinase catalytic domain3.9PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain3.9PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain3.9PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain3.9PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain3.9PR00109
Profile scan predictionP-Valprediction_id
C2 domain8.68PS50004
Protein kinase domain39.142PS50011
Protein kinase domain25.333PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain2.7SM00220
Serine/threonine- / dual specificity protein kinase, catalytic domain1.2SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-692
NN-scoreoddsWeighted Score
0.5571.3710.003
*** None ***
TypeScore
cytoplasmic652
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein bindingGO:0005515IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2102 bases(100 bases per row)
ATGCTCGTGAGAGTCCACGTCGTCGAGGCCAAGGACCTCGAGAGCAACAAGATGTTCCGCAGCGTCAACCATGCCTACGCCTACCTCTACTACGCGGGCA
AAAAGGTCACGTCCGACGTCGCCCACAAGCAGAAGAACGCGCCACGCTGGGGCCTCAAGAAGCGCTTCACCAAAATCGACCCGGCGACCGACAGCAAGGT
TCGCATCGACGTCTTCGACCAAGGCCAGTGGGGCCGCAGCGAGATGTTCATCGGCTTTTGCGAGGTCGCGGTGCCCGCGCGGCCCAAGCGCGTCGAATCG
TGGGTGCCGATCACACTCGAGAACGCCACAACGGGCAGCGTTCTCGTGCACATCGACTGCGTTGCCGAGCAGAGCGAGGTCGCGCCACCGCGAGTGGCCC
CGTACTTGCTCCCGATGCGCCGCACGAGCTCTCTCAGCGACACGTTTCTGCAGCTCGCAGCAGACCTCCCCGAGACGGTGCCGCGCATTGAGCCGACCGA
GCTACGCAGGTGCCTCAACCTCGGCAGCGGCGCCTTTGGCAGCGTGCACAGCGGCAGCTACAAGGACTTGACGGTGGCTGTCAAGACGTTTCACACCAAG
AGCGGCAACGAGATCGAGACGTTCAAGAAGGAAGTCAACGTCATGGCCAGTCTCGACTCGACGCATACGGTGCAGCTCCTCGGTATCTCGCACGCCGAGT
ACGACCAGCCGCAGATCGTGATGGAGTACATGGACGGCGGCAACCTCGATGCGCACATCCAGTCGCTCGCCACGGCGCCAGAACACGACGTGGGCAACGT
GCTGCCTCTCGCCTGCGACATCGCCAAAGGCCTCGCGTACCTGCACGCCAACAAGATCATCCACCGCGATCTCAAACCGGCCAACGTGCTACTCAGCGCC
GACAAGAGAGTGGTCAAGCTCGGCGACTTTGGCATCTCGCGCGAAGAAGACGTCGAAGAGTCGATGACCAACGGCGTCGGCACGACGCTATGGATGGCGC
CCGAGGTCATGCAAGGCGGCCGGTACTCGGTCGCGGCCGACATGTACGCATTTGGCGTCATTCTCACCGAGCTCGAGACGCTGCAAAGACCGTATGCGGG
CCAAAGGTGCAACCAGTACTTGCTGCAAAGCCAGATCATCCAAGGGCTTCGGCCAACGACGAGCGCTCACTGCCCGTCATGGTACGCGCGGCTGGCGCAG
GCTTGCATGCAAGCTGATACGACCAAGCGGCCATCGGCCAACGCTGCCGTCAGCATCCTCGAGGCCCACATGTCGCCGCCCTGCTTTCAACCGATTCCCG
AGGAGCTGCTACGTGACATTGTCCCGTTCACGTCCAGCAAGAGCGGCGTGCTTGGTCGTGCGACGCTCGCGCTCCGCCCCGTTGTCCTCAAGTCGTTTCC
ATATATGAATCCGGATGTCTTTGAGGCGACCGTGGACGTCATGACGGCAGTCGCGTCACCTCACACTGTGCCTCTTCTCGGCACGACGTCTCTCTCCAAC
ACGACCATCTTTGGTCTTGCGTCGCCTTGCGTGCTCGTCATGGGTCACATGGGTGGCGGCAACCTCCACACGTGGCTCAAGCAGCGCGCCAACGCCGACT
TCCTTGATACGGCGCTGGCACTCGCCGAGGCTCTGGCGTTCTTGCATGAGAAGAAGGTGGTGCACGGCAACCTCACGCCGTCGAATGTCCTCTTTGATGC
TACCGGCATCCCCAAGCTTGCCGACTTTGGCTACGTGCGCGACGAAGACATGATGACGACCAATGGCGGCAGTGCCACGCATTGGATGGCGCCTGAGATC
TTCCACGGCAGTTTGCCGTCGACCGCGTCAGACGTCTACTCGCTCGGTGTGCTCTTGACGCAGCTCGAGACGGGCCACGAGCCGTACTGGGACTTCCGAG
GAAATCTCCAGCGCCGCGTCGCACAGATCGTGACAGGCGCGCTGCGGCCGTCGCTGAGTGCGTCGTGCCCGCACTGGTATCGTGAGCTGGCGCTAAAGTG
CATGGCCGGAGAAGCGATGCGTCGCCCGTCCGCAGCCGAAGTTGTGGACGAGCTCGTCAAATATATGGCGACGCCCTAGTTGTTGTACGTATTAATATGT
GA