Transcript Name :
Sapdi_VS20SDRG_00026
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.3980.55631
InsideOutsideTMhelix
1-6
30-282
7-29
NN-scoreoddsWeighted Score
0.7645.2930.011
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        971 bases(100 bases per row)
ATGCTGCGTCCGAGTCGCAACATCCTCCTGCAACTCAACGTCCTCACCGCCAGCTTTGCGCTCAATATCGCGCTTCTCGGTGTCGGCGGCAACAACAAAA
TGTCATTCTACCTCCCGTTCCCGCGGTTTTGGCAGCGGCCCTTGGTGGTCTTTTCGCCTACGCCCGCCGGACGCCGTCCCCAAAACGTACCAGCGACGAT
GACGACGACCATAATGATGACGCTGAGGCTTTGGCCACGCCCGGACGATCCCGCTTCTTGTCCTGCTCGACGGTGCGCTCCTCGCGTATGCCAGTATCGA
CGAGAGCTGCGCGTTTCCAGGCTTTTGGGCGCTGCTGCCGTCAACTCGTCCTCTTGGCTGCGGGTCCCGACGCCGTTCTCGACGTACGTCACCGGTGTTG
ACCTGCCCAAAGACTTTGTTGAGTTTGCAGACCACGCCGACAAGAAATCGCCCGAGACCTGTGTCGTATTGCGCCCGGGTGGAGAAGCGCGCAACGGCCT
CCTCTTTGTCATTGGCGACTCGCACGCGGACATGCTCAAGCCCCGCTTTGTGCAGTTGGCGACAAAGAACGGGCGGCCCGAGTTTCACGGCTACCTCACC
ATGGTCAAGCCGTGCGCTTCGTTTCGCACTGGTCCAAGTACCTCAACCCGGGCAACGTGACGCATGGTGCGTCGACGCCGGTCTGCTGCGCGTACGCCGG
GCTGCCCTGCACCGAGCAGTCGATAGACGACGTTGAAGCGATTCTGAGCAACTTTAGCAGCGCGCTTCAGGAGCTGAGAGCCTTGGGTAACCAGGTATTT
GTGGCCGACCAGAGCCCCCAGAGCGGCCGCCAAAACCCCAACATGTGGCTCAACGGCGGCGACGGCGTGGTGCCGCCGCCGCTCAGTCGTGCCGAGTACA
ATGCCTTGCACGCGTGGCTTCTCACCCGAAATGCACACGGCTGCGACGTTAGCCAATGCGACGCTCGTTGA