Transcript Name :
Sapdi_VS20SDRG_00020
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-663
NN-scoreoddsWeighted Score
0.672.0460.004
*** None ***
TypeScore
cytoplasmic565
GO
*** None ***
*** None ***
*** None ***
Sequence
        2116 bases(100 bases per row)
ATGCGTCGTTCGCAGGCTTGACGACGGCGCAAGTGTGCTTCAAGTACGTTGTGCCGTACACCGAGACGTCCGGTCAGTCGCTCGTCGAGCACGTCCGGCT
CCACACCGCGGACGCCGACTACGTGCAGCCAGCGACTTGGTACATTAGCCACGCGTGGCTCTACACGTTTACCGAGACGCTCTCGTCGCTCGAGCTCTTC
TTTGCGGCCAAGGGCATCCAAGACCCCGTCGTCTGGTTTTGCGTCTTCAACAACAACCAGCACGAAGCCAAGGACTACCCGTTCTCGTGGTGGCAGTCGA
CGTTCAAGGACTCGCTCGCGGCTATTGGCAACGTCGTCATGATCATGCACCCGTGGAAGAACCCGATCACCCTCACGCGGTCGTGGTGCGTCTTTGAGGT
CTACGTCGCCATCTCGGTGGGGGCCAGCTTTGACGTTGCGCTCGCGCCGACGCAAGCCGACAGCTTCTTCCTCGACATGGCCAACGACGACATCGATGCG
TTCTACGAGATGCTCGGCAGCATCAACAGTAAGAACGCTCGTGCGACCGTCGCCACCGACAAGACCAACATTGACGCGGTGATTGCAGCCGAAGTCGGCT
TTCCGACGCTGGACCGTATGGTCTTTGCAGTGCTGGAGAATTGGATGCAGTCGGCGCTGCGTGCGCGCATCGACAAGTCGCAAGGGTCCTTGGACGTGGC
CAAGTACAACTACGCCCTCGCCGGTCTCCTCTGCCATCAGTGCCACTTTGACGCCGCGCTGGCGCCCTGCGAGACCGCGCTGCTTCTGTACGAAGGGACG
CTCGGCCCGAGCGCACGCGAGTCTCTCGAGACGCGGGCTTTCCTCGGAACCATTTACGGACTCGAAAACAAGCCCATCGAGGTCTGGGAACCGATTTTGG
TTGATGCCATTGCAGCGCTGACCGACGTCGGAGGCCGCGCCGACCCGGCCGTTATGAACGCCTTGTACCACTTGGGGCTCTTCTACATCTTGCATGGCGA
AGTCGAGAAGGGCCGCGTGGTCTGGTCCGAGGCGCTGCAGCTCTTCCACGCGGTGCTGGGCCCCAGTCACCCGCGGACACTCACCATCGTCTACACTGTC
CGGCAACTCGACGACACGAGCACGATGGACGCAAACCTCGCCGCAGAAATGGCCATCGAGTGCTACGTGGGTCTCCTCACTGTCCTCGGCAAGGACAACC
CGATGACGCTGAATGCGATGATGAACGTCGGCGTTGTGTACGCCGAGCACGGCAAGCTCGACGACGCTCTCGAGTGGCACATGGAAGCGTACACGGGCCT
CGACCGCGTCTGCGGCCTCACGCACACGCACACGCTCTGGGCACTCTATAGCGTCGGCGAAACACTGGTCGCTCTCAGTAGGTTTTCTGAAGCGATTGCT
AATCTGCACCGCGTCCGCGACGGCACCAAGGCATTGGGCATGGACAACTCGCTGCTGGCGGCGCTCGGTACAATGTCGCTTGCCTCGCGGAGTGGTCCTA
AGCGTCGTCTCTTGCGTAGCGTCCGAGCAGCTCGGTTTGGCGTACTTTTCGCTCGAAGAGTATGATGTAGCCATGACCTTCTACTTGGCGTCCGTGCGAT
CCCTCGAGGTCCTCAAGCGACTACCGGCAGCCACTATGTCCATCGTGCGCTTGCTCGCGTGCTACGACCGCCTCGACTCGCCTGTGGCGCTGGCGGACTT
GGACGCAATGAGGCGCTTTGCTCTTGCCGCGGATATGTGGCACGAGACGCGGGAGAAGGTGGGCTGCGACCTCTGCGATATTCCCGAGCTGTACGGCACC
GTGTACGTCTGCCCAGTCTGCCCCATCGGGACCCAAGTCGCGTGTGCGGCGTGCTATGCGATCGTGCCGCAGTGCCCCGAGTGCCAAGTGCTGGACCTCG
TGCCCAGTTTGCCGCCGCCTCGCATGCTTATGACGCGCAAACTTCGGCTTCTCGCAACAGAAGATCAACCGGCTTTGCTTGCGTCTGTTGAGGACGAGCT
CCGCGCGTACTGCGACACCCATGGAATCGATAGCATCGACCTGAATGCCGAGGTGACACCAGAGACCGCCAGCACATCGACCGGCAAGCCGGCCATAGCG
TCTCGTCGCAGACTAG