Transcript Name :
Sapdi_VS20SDRG_00011
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
DnaJ domain1.1PR00625
DnaJ domain1.1PR00625
DnaJ domain1.1PR00625
Profile scan predictionP-Valprediction_id
DnaJ domain17.238PS50076
HmmSmart predictionP-Valprediction_id
DnaJ domain6.1SM00271
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
DnaJ domainIPR001623
*** None ***
InsideOutsideTMhelix
1-6
163-215
27-139
7-26
140-162
NN-scoreoddsWeighted Score
0.8113.9860.008
*** None ***
TypeScore
mitochondrial391
GO
*** None ***
*** None ***
*** None ***
Sequence
        795 bases(100 bases per row)
GTTTCGAAGATGGGCCGAGCAGCGACGACGGCGGTCGGCGCGGTCGTCCTCGCGGCCATCGCCGGCGTCTGGCATACCGGGCTGCTGGAGCCTTACTACC
ACGCAATCCTCCATGGCAATGCCCCCGACGCCACGTTCTACGAGGTGTGTCATTGCGGTGGCGAAGGGTCCGACGCCATTCGCTGTCGCTGTAGGTGCTA
CGCGTCGCACCGACAGCGTCACCCAGCGAGATCGCGGCGGCCTACCGGTCGCTGTCGCGTGAGTACCATCCCGACAAGACCAAGTCTCTCTCGCCCGCGA
TGCGCGACGCGCACACGCAAGCGTTCTACCGCGTCGCCGGTACGTGTCCATTCTGCGACCCTGCCAATGTTGGCGATGAGCTAGCGGCGTACGAGACCTT
GTCCAACGATGACCGACGACGAGACTACGATCGCCAGCTACACCAAGTCGCCAAGCCGCCGTCCATGACGTGGCAGTCGCGCGTCCATCTCTGGTGGTGG
CAGCTATGGTATTCCTTGTCGTTTGAATCCATTGGCTACGTTGTGTGTGGCCTCGGCCTCGTCACGATTCTCTGCGAGTACGTGCTGGCTCCCATCCAGC
AGCGCGTCTTCCGCTCCCGACACCCACCGTCCAACCCGGATGTGCAGCAGCCTGGCACGAGCCTATACGAAGCGCGCTTGCGGCTCCAAGCCCAGTACGA
CGCTGACGCACAGCGCCGCTCGCAGCACCGACGGGCGACACGAGTGCGTTAAACGAGTCGTATTATGCTTTTACTCGATCACGTTTTGGTCATTG