Transcript Name :
Sapdi_VS20SDRG_00018
Orientation:
(+)
Number of Exons:
11
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Src homology-3 domain3.7PR00452
Src homology-3 domain3.7PR00452
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain13.87PS50294
WD40 repeat10.107PS50082
Src homology-3 domain16.954PS50002
HmmSmart predictionP-Valprediction_id
WD40 repeat0.97SM00320
WD40 repeat0.83SM00320
WD40 repeat8.9SM00320
WD40 repeat1.6SM00320
WD40 repeat93SM00320
WD40 repeat0.0098SM00320
WD40 repeat0.97SM00320
WD40 repeat34SM00320
Src homology-3 domain2.4SM00326
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1139
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3953 bases(100 bases per row)
GCCATGGCCGAGGAAGGCCTCAATGACCAGCGTACGTACATGGACCTTGGGACGTTGGTGGCGGCTGACGCAGGCGTAGTCGTGGCGCTCGTGACCGACC
TCGTCCGGCGGGAAGTCGACGCGCTCTTCACATCCCGCGACGCGGCGATCGCGACGCTCACGGCGCAGGTGCAGACGCTCATCTCAGACGTCGAGCGCAT
CACGGCCGAGCTCGAGGCGCGCGCATCGTGGAACCGGCCCGTCGTCAAGTACGAGCTCTCGCCAGTAAAGGCGCTCGAGTCGCCGACGCGCAAGAAGCCT
ACGTCGTTCCAGCGCCTCCCGTCGCTGCTCGACCTCGCCGACGACGCGGGCCGCAGCGAAGACGGCAAGCTCCTCTTTGGTACTACACCATACCTTGTTC
TATTGACAAACGACAAACGGTGTGCTAGCCAAGAACCTGCCGCGCGTCGCCAGCATCGACAAGCAGACGCAGCGGGACACCGCACAGCTCAAACAAAAAG
CCTACGAGTCGGCCATGACCCGATACCCCGAGTGTCGCAGCACCGTCTTTGCGCCGAGCTCGTTCAACCCGGCGCGGTCGACGCTCTTGGACCCACCTGC
CATGACGCTGCAGCTGCACCGGGCGACCGGGTACCATCCGAGTGCAACGTCCAACGTGCTCTACTTGGCGTCCGGCGAGGTGGTGTGGTGCACGGCGATG
CTGGTCGTCCTGTACGCCAAGCGCCGCCAAACGCAGCGCTTTTACAGCGGCCACACGCGCGAAATCACGGCGCTCGGCCTCCACCCCAACCAAACCACGA
TCGCATCCGGCCAGTGCGGCAAGGACGCCGCTTCGATCCTCGTCTGGGACGCCGTGCGGGCCAAGGACGACCCGACGCACATTCTCGCTACCCTCCGCGG
CCAAACCGTCCATATCAAGAGCATTAGCTTCTCCCACGACGGCAAGCTCGTCGCGTCCTTGGGCGGCGACCTCTACAACTCGATTTGCATCCACGAGTGG
CAAGACGAGACGCTCTTAATCAAGATTCGGTGCGTGGGCGCATTGTCTAGTACATCGCTGACAAACTAGTTATGACTAGAGGCCACAGCGCCAAGGTGCA
CATGCTCGCGTTCAACCCGTACCAAGCGTATGGCATCCCGGACAAGACCAAGACGCTTGTCGCGCCGGCCAAGAACGGCAAGAGAGCCAAGTACGCTGTC
GACCTGCACGCACAGCCAGGCCAAGCGCTGCGGGACGAGGACGCCTGCTATACACTCGTACCTCACGTTCTATCGCCCGAGCTTGCATTTGGGTGGTGTA
GGTGTCGTGCGGCGTCCAGCACATCAAGTTTTGGACGCTGACGCAGACCGAGTACGCCCCGCCCGTCACGGCTGAAAAAGTAGCTTGGGTTGTGATTTGA
AAGAGGTACAATATTGTCGATGACTAGGAAGACAGTGCGTTTTACGGCTCGTCGTTTGGCGGACCGAATCGCATGCGTCAGTTGACACCCCATGAAAAAG
TGTGGAAGCTCGAGGGCAACCCGCCGTTGATGAAGAGCGACCCGCAAGACTTTACCTACGTGTGCTTTTGCAACGACATGCCGCCGCTGCACGTCTACGA
CGAAGGCTCGGACCAGCTCCTTCCGTCGCCAACCGTAAGCGACATCTGATACCTTCGGCTCTAAGATGGGACTAGGCCAAGGAGACGTCACTGGGGCGCG
TCGTCGCTGGCACGGCCAAAGGCGACTTGTATGTCTTTTGGCAGCCGCGCAAGATGCCACTGTACGCCGCGCACGTCGCCGACCAAGCGATTGTTCCGCG
CAAGTGGTGGGAGCTGCCGGTGACCGAGTGGCAGCTTCCGGACGACACGTCGGCGCTCATGCAGCATCTGCACTTTGAGCCCACCGCCAAGCTCGTCGAG
ATCGTGCCCCACGATGTCGCCACCGGCAACAAGTTCAAGGTCTCACGCCACGCACAAGCCGAGCTCGCCGACCTCACCCAGCGGCTTGCGCTCAAGCCCG
ACGCCAAGTCGGTGCTGGATCGCATGCGAGCCATCGAGTACAAGGGCCCACTCGCCCACACGGCGCTCTGCTCGCACGTAGCGAGCGACGGGAAGCGCAA
CCGCATTGCGTCGGTCGGCTTTGACGGCCTCGTGCATGTCTGGTGCTTGCATCTTGTCGAGCCGATGCGGGTCCCAGGCACGCATACGCTCGGCGAATAT
GCGCCGATCGGCGGCGCGGCCAACAGCTCCGACGGCCGGCACCGCCTCCAGCTCGAAGTGTCGCTCGAGCTGCCGGTGAAGGCCAAGCCCGCGAGCTTAT
CACTCCAAGGCGACGCGCTCCTTCTGGGCCTGGCCAACCATAGCATTTACGAGTGCATCTTGACCGACAACGACGACGAGGCTGAGACCGACTGGGTTTT
GCTCCAAGAAGGCGTCGATGGCGCGGTTGTTGGCGGCGCGATTGTCGACGACACGCTCGTCACGGTTTCGACCGACCAATCGCTGCGCTGGTGGTCACTG
CCGACGCACGAGTGTCTTGGTCGCATCGGGCTCCGGAGCATGGGCACGTGCGTCGACGCGCAGTCGTCGACAGCCGACGTCGCTATCGGGTGTGCGTCCG
GCGAGGTCAGTTCCTTTGCCTTTCTTCCATCTCACTCTCTGAATCTGAACGTGAATCTGAATCGATAGCTGCTGATTCTGAACGCCACCGGCGACATGAC
CGAGAAGCGGCTCATCAAGGTCGTTGCTACGGATGCGATCACGGTCGTCAAGATCAGTCCGGATGCCAAGTACATTGCGGTCGGCGGCAAGGACAACTGC
GTCTACCTCGTGGACACAACAAACTACAAGCGCGTCGCCAAGTGCGAAGGTCCTCTCATCGTCGTCTTATCATGGCGCTAAGATCTTGGCGCAGGCCATG
CCACGTACGTCGCCCACATGGACTGGAGCGTCGACGGATACTTGCTCCAAACCAACGCGGCCGACGGCGAGATCTTGTACTGGCAAGTGACACCCGGGCC
AAATCTCCGGCAAATCACCGATGCCATCCTCGTACACTGGACTCTCATCGCATGAAGATGACTGACGCAAGGTAGATGCGCGATATCCTCTGGCACCGGT
GGAGCTGCGTGTACGGGTGGTCCGTCCAAGGTATCTGGGGCGACGACGGCAGTGCGTGCACCGACATTCTCTCGCTCTCTCCGCTTGACGTGCCGCCGCA
CGACCCGAGCGCCGTCGCCGCCGACGTCCACCATGTGCTGGTCGGCCACCGGGCTAGCCTCCGGAGCTTTCGTTGGCCCTGCCTGCGCTCGGCGCCCTAC
CATGTCTACGACGGCCACGCAGGCAACATCACAGCGGTCCTATGCTGGTCCTATGCCGGCAGCGCACGGGTGCTCACGCTTGGTGGCGCCGACAGCACGA
TCCTCGAGGTACTTTAGTGCGAGGTGATACCATCATAACCGGCTAAGTAGTGGCGCGCGTTGCCGTCGACAGCAACGCTGGCCGAGGCAAGTGTCGACGA
CGAGACGCCGCTCGAAGCAACGGAAGCGGTGCCGACACCCGAGGCGACGCCGGCGTGCGACGACGACGACGCGAGCGACGTGGGTGACGCCGCCGTGACG
CCGGTGCGCCCGGCGCGGACTCCGGACCGCCGGACGCCGCGAACGCCGCGGGTCAAAGACGACGGCGTGCGCGAGACAAGCCCGGTGGCTGCGACGATCG
CGTGTCGGCGCGCCAAGTTTGATTTCACAGGCGAGAACGACGACGAGCTGAGCTTCCGCGCCGGCGAAGTGGTGCGGATCCTGGACAAGCGGCCCGGCGA
CTGGTGGTTTGGCGAGACGTGCAACGGCCAAAAGGGCATCTTCCCGAGCGACTATGTCGAGGCCAACGACGGGCTTCTCGAGGTGCTGGCATCGTAGATC
TTAGTGAGGACAATAATATGACGTGGCAAAATGTGAGACGGGTTTATATTAGA