Transcript Name :
Sapdi_VS20SDRG_00016
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Beta/gamma crystallin9.449PS50915
HmmSmart predictionP-Valprediction_id
Beta/gamma crystallin0.0013SM00247
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Beta/gamma crystallinIPR001064
*** None ***
InsideOutsideTMhelix
283-309
1-259
260-282
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1113 bases(100 bases per row)
ATGCGTCGTCTGCTTATTCTGCTAGGCGCCGCCGCGCACGCGCAGATCACGCTCTTTGAGCTTCCGGCGTTCCGCGGTCGGTCCCTCTTGCTCGCCAGCG
ACGTCGCCAACGTCTCGAGCCTCTTATCCGGCCACAGCGCGGTGCAGTCGCTCGCTATTGACGGCTCTTACATTGTCACAACATTCGACCAGGTCGGCTT
TCGGGGCCAGCGCGCCGAGTGGCGGTACTCGACAAGCTTTACAGCAGCGTGGACGCATCGCATCCGGTCGCTTCGCGTGACGAATGCCAGTGCTAGCATC
GAAGCGCCGCCGAGTGCACTCGACTGGAAGTTTGCGGCGACCCGCGACGGCTTTATCATGGTGCGCAACTCGACGACGAGCGCGCACCTCTACGACTTGC
TCGACCACAACGACGACATCGAGCGCCTCCGCCCGGCGCCATGCGGCCCACTTCGGGTTCAGCACTGGAACAACACGGGGTATGGGCTGCACGAGTGGTG
CGCTAAGGCTCGTTTTGGCCTCAGCTCGAGCGGGCGCCACGGCTGGCATTACATCCCGGCACGAGATCCCAGCGGCATCGTCATCAAGGTGCTCGACGAA
TCGCTGTGCGTCCAGGCGCGGACCAGCGCGTGCGACTCGTTCCCGTCCGCCGAGGTGGCCGATACGTGCGCACGCGCGCTGCTGTGGAGCAACGAGAACG
GTACGTACGACCTCGACGCGTTTTACCAGTATGGGCATTTGTCCGACCACACCGGGCCGTCCAACTTTATTGGTATACCTTCATTCCTTTCTCGATCTAG
GGTATTCATGATGATCCTGATTAGAGTCTTTTGTCTTTGGCTTCTTGGTGGCGTCGACGCTCCTGGTCGTGCTTGCCGTCCTCGTCGTCATCCGCCTTCG
CGCCAAAGCCAGTCGCGACGTCGATGCGACCTACTGCTCGAGCTGCAACGAATTCGACGAGCCACAGGCGCCGTACACATAGCTGTTGATCGATCGGCGT
ACCTGGCGACCTTCTTTGTATTGTCCAGTGTCAGCAGGCGTGTGTTTTACACATGCAAATCAACGTGCGTGTGCTAAATGTGAGAAACGTGAAATACGTG
TGATTTGCATGTG