Transcript Name :
Sapdi_VS20SDRG_00043
Orientation:
(-)
Number of Exons:
1
Description :
TKL protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Profile scan predictionP-Valprediction_id
Protein kinase domain41.008PS50011
Protein kinase domain26.096PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4.2SM00220
Serine/threonine- / dual specificity protein kinase, catalytic domain1.5SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-758
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2326 bases(100 bases per row)
GCAAGAAATGGACCTCGTCGTCAAGGTTCCGCAGGCGCACGACCTCCGGAGCTCCAAGTTCTTTGGGAACGTCAAGCGCCCGTACGCGCTCGTGCGCTAC
GCCCACGACAGCGCCCAGACCGACGTCGACCCGGCTGGGCGGGAGGCGCCGCGCTGGAAGTTCCGCCACCGCTTCGCCAAAATCAACGTGGCCGCCTGCC
CGTACCTCCAGGTCGACGTCTACGATCTCGATACGCACGACGGGCCGGGCGCTGCGATCGGGACGTGCGAGGTTCCCGTGCCCACGAGCCCGTCCTGCTT
CCAGCAGTGGTTCAAGCTCTCGCTCCACGACAAGATCACGGGCTACATCTACATCGTGCTCGAGGTCGTGGCGCGGCGCCGTCGCGACGGCTCTAGCCAG
CGGTCCATCGACAGCGCCGAACGCCGATCAACCGCGAGCGTCGAGCGTCGGGCCTCCGATGAGCGCCGGGCGACTGCAAGCTCCGAGCGCAGGTCTACGG
CCAGCCTTGAGCGGCGACCCGAGCGGCGGCGCGACAGCGTCGTTTCGACCGCGTCGTCCAGCGGCAGCAGCGGGTCGGCCAAGAAGAAGACGGCGCTGCT
GTCATCGAGCTCGTCGCTCAGCGCGTCGTTCCTCCAGCGCACGGCAAGCCTGCCCGAGACAATTCCTCGCATCGACCCCGCTAATCTCCGGATGCGGTCG
GCGCTCGGTCGCGGCGCGTACGGCTCGGTTGCGCTGTGCATCTACAAGAAGCGTCCTGTCGCTGTCAAGACGTTCCACGTCACGAGCGGCAACGTCAACG
GCGACGACCACGAGTCGTTTGCAAAGGAAGTCGGCGTCATGTACCGCCTCAGCTCGTTCTACACGGTGCAGCTCCTCGGCATCTCGCACAACGAGCACGA
CCAGCCGCAGATCGTGATGGAGTACATGAGCGGCGGCAACCTGCACGAACATCTCAAGCTGCTTGGCGCCACTGACGACACCGACCACGACGTCACCTCG
CTACTCTTCATTGCGCTGAGCGTCGCCAAAGGCTTGGTGTACCTCCACAACCAAAGCATCATCCACCGCGACCTCAAGCCCGCCAACGTGCTCCTGAGCG
ACGACAAGGTGTCGGTCAAGCTCGGCGACTTCGGTATCTCGCGGCAATATGACGTCGAGTCGATGACCAACGGCATCGGCACGACGCCGTGGATGGCCCC
CGAAGTCATCAGCAGCGGCAACTACACGGTGCAAGCCGACATCTACTCGTTTGGCATCCTCCTCACCGAGCTCGATACGCTCAAAGCGCCGTACGCCGGC
GAAAAGTGCAGTCCGTTCGTCCTACAAGGCAGAGTCCTCAACGGGTACCGGCCCGCGCTGCGCCCGACAGCACCAGCTTGGTACAAGCGCCTCGTGGCCA
GCTGCGTAGCCACCGACCCAAACAACCGCCCGACGGCGGCCGAGATTGTCGAGATCCTCACCGACCAGATGCCAACGTCCCGCCGCCTGGTGCTGCCATC
AGTGACACTGCCCCAGATCCCGCCGTCCGAGGTGGCGCCCGTCGGTGTTGTCGGTGGCAACGCGTTCAGCTCCGTCGCCCGCGGGATTTACGGCGACCGT
ATGGTCGCGATCAAGACGTTCCTGACGCTGCACCCATCGAGGGTCGAAGCGGCGGCCAACCGCATGGCACGCCTTGGGTCCGAGCACACGGTTGAGCTTC
TCGGCCTCGCCGGCTCGACGCTCGTGATGGAGTGCATGCTGAATGGCAACCTGCGGCAGTTCCTCGCACAGAAAGCGCGGCAGGCGTGGCCGGCCCAGGA
CCTGCGCAACGTCCTGTATGTCGCGGTGGCGCTCGCTAAAGGGCTGGCGTTCTTGCACGCGAACGACCAAGTCCACGGCAGCCTCGTGCCGACCAACGTC
CTCTTTGATGCCAAGGGCGTCGTCAAGCTCAGTGACTTTGGCTACGACCGCGACGACGACGACGTGACGGTGAGCGGCGCGTCGACGATGGCCTACCTAG
CGCCCGAAGTGCTCTTGGGGCAGCCGCCGTCGTTTCCTGCCGACGTCTTTGCCCTTGGCGTCCTCTTCACGCAGCTCGAGACGCTCCAAGAGCCGTATGC
TGACAACCACAGTGCGCTGACAAAGAAGGTCGCGCAGGTCTCGGCCGGCTTGCTCCGACCGACGCTGAGTCCGTCGTGCCCCGCCTGGTTCCGGGACCTA
TCGCTTCTGTGCATGGCCCAAGACCCGACTCGTCGTCCGACGGCCGCCGACGTTGTCCAGCTCCTGAGCGACAATATGCAGTAGCTAGTATAATGGCGCC
AACTATGTATTATTTGCTATGTAATA