Transcript Name :
Sapdi_VS20SDRG_00041
Orientation:
(-)
Number of Exons:
6
Description :
Ras-like GTP-binding protein A
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-300
NN-scoreoddsWeighted Score
0.6751.60.003
*** None ***
TypeScore
mitochondrial435
GO
*** None ***
KO ID
K16185
*** None ***
Sequence
        1226 bases(100 bases per row)
TTCAAAGCGAGTTTTGCAGCGCCGACGTCCGCAGCATGAAGAAGAAGGTCCGTCGGTCGCGCTGGCCGCCAGCTCATGGCCCGCCTGCCGTAGGTCCTCT
TGATGGGCAAGTCCGGCTCGGGCAAGACCTCGATGCGCTCGATCATCTTCGCCAACTACCTCGGTGCGTCTGCCTGCCCGCTTGCCATGTCTGACTGCGC
ATGATGGTGTCTAGCCCGTGACACGATGCGCCTTGGCCCCACCCGTCGGTGCTTTCGCTTCTCGCCTTGCCGCTCACGCATCCTACGTAGTCGACGTCGA
GCACTCGCACGTCCGCTTCCTCGGCAACCTCGTGCTCAACCTCTGGGACTGCGGCGGGTACGCCTGCGCGTTGCCTTGCCTCTATTCATGCACGCTCTTC
TAGCCAAGACGCGTTCTACGAAAACTACTTTGAGAGCCAGCGCGACCACATCTTCCGCAGCGTCGAGCTGCTTATCTACGTCTTCGACATCGAGTCGCGC
GAGCTCGAAAAAGACATGAACCACTTTGACGGCTGCCTCGAAGCGATCGAGCAAAACTCCGAGTCGGCCAAGGTGTTTGTGCTCATCCACAAGATGGACC
TCGTGCCCGAGGCTCAGCGCGACGCCGTCTTTGAGCAGCGCAAGGACATGATCTTGTCGCGGACCGGCGTACGTCGTACTTCCGTCCTCTTCGCCTGCAT
CATGCTGCTTGTAGCAAATCCCAACCGTCTGTTTTGGCACGTCGATCTGGGACGAGACGTTGTACCGCGCGTGGTCGTCGATCGTCTACTCGCTCATCCC
CAACATGCAGGACCTCGAGCACCATCTAAATGTGTTTTGCTCCATCTGCAACGCCGACGAGGTCGTGCTCTTTGAGCGAGCGACGTTCCTCGTGATTGCC
AACGCGACGCACACCACCCATCGGGACATGCACCGCTTCGAGAAGATCTCCAACATCATCAAGCAGTTCAAGCTCAGCTGCTCCAAGACGCAGGCGCAGT
TCCAGGGCATGGAGGTGCGCAACTCGAACTTTACGGCGTACATGGACTTCTTCACGACCAACACGTACATCATGGTCATCATGAGCGACGGCTCGATCCA
AGCGGCGACTACCCAGCTCAACATCAAGGCGGCGCGCCCCGTCTTTGAACGCTACGTGCAGCAAGCCAACTAAACTGGGCAGACAGGATGATGCGACAGA
ATCTACGTCTACGGTTGTTTGGGCTA