Transcript Name :
Sapdi_VS20SDRG_00036
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5680.72919
InsideOutsideTMhelix
293-319
1-269
270-292
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1019 bases(100 bases per row)
ATGCTGCGTCTACTCGTCCTTGGCGCATTCGCTCTATGCAGCAACATCAACGCGGCAGCCGTCACGTTCTACGAGCACCCGGCGTACCAAGGCCAGTCGC
TCACTGTTGCCGCTGCCAACGACGCCACAACCGCGCTCCAACGCTGGTCCAAACCAATCCAGTCGATCACGCTCGATGCCGACACGGAGCTCGTGACGTA
CGATCGCACAGAGCGACAAGGCCAGGCCGCGATCTGGCGCTACTCGACCACACGCCTCGGCAGCTGGACAGAGCGCGTCGCGTCGTTTGAACTCCGACAA
GCAGACACGGAAGCGACAGTACGCGATGTCAACTGGAAGCACCTCCGCGTTGCCTCTGGCTACGTACAAGTGCGGGCGACCGACACGATCGAGTGCCGGT
CGTTTGACGGTGTCAACTGCAACGTCAATCTGGCAAACACAACCAGCGACAACCGTGGATCGGTGCACCCGGCTCGGTGCGGCGCCGAGCACGCCATGTA
CTGGGGCGTCTCTGGCTTTGACGACGCTACGTCCTGGTGCTTGATCGCCAAAGCCGCATTGGCAGCGCCGACAACATCGTGGTCGTGCGTACCAGAGCAG
TCGAATTGGCTCATCGTTTCCTCGTCCTCCGACGGCTCACGCTGCGTGGGCCTCAATATATGCGATCGTTTTGGGAGCCTCGCAAGGTGTCAGGACGTCG
CGTCGACGTTGCTTGGTACGGACATCGTCACCAGCTCTCATTCGACAGAAAAGCCAGCGACCGAGACGATCCAGGCGTCGGCTTCGTCGACGACGTCAGC
GGCCAAATCGGGCTGTACGTTCGCACCGAGTGCTCGAGTTTGCTATGCTGTGGGACTATGGACTTGTGGTTAGGGGTATGGGGCTTTCCGGCGATGATTG
CAGGGTGTTTGACGGTCGGAATTGTGGTTGCGATCAAGCTCAACAAACAAACATCAGCAAATCCGCTCGAAGCCACGTACTGCTCGAGCATCGGTGGCGA
CGACGACTTGCACGTGTAG