Transcript Name :
Sapdi_VS20SDRG_00046
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-49
105-124
185-196
73-81
148-161
220-580
50-72
82-104
125-147
162-184
197-219
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1743 bases(100 bases per row)
ATGGTGGTGCGCGTCGAGGCCTATCTCGCGTCGACCGACGATGTAGCCGACCTTGGCTTACCGTCTCCACCCAAGCTGCGCGTATTTGGTGAGCCACAAG
CTGCGCCACCGAGCTGCCACGTCCTCTCGCACACGAGCTACCAGCTGCTTTGGTGGGGCCATCTCGTCTCGCAAAGCCTCGTTCTCTGCGTGCTCTTGCT
TCGCGTTCAAGCGGTCTTGGCGTCAAACGCTCAGGACAACAGCAGCTGGGCCGTGCTTCTGCTTGGCAGCGCGATGTGCCTAGCGACATTGGACCTTAGC
GCCCTCGTCGTGGCGTCGCTCATTGCCAAACGCTTCCGCTTTGCTCGTTCATGGCTCGCGTGCGAGGCGTCGCTAGCGACGTGGTCCGCACAGCCGTCTG
CCATCGCTCTCATGGGCTCTGTCGCACTTGCTCTCTGGTTGGTTCAGCTCCACGATGCGAGCTACTTTAGCAGTAGCCGCACTGCCAGCTACGGCGTCCT
TGGGCTTTGGTGCGTGGTGTCGGCTTGCACCGTGCAGTTGAAAACTGTCGGTCGTGCTGCATGGCTGTGGTCGTTGCAAACATGGACGCTGCTCGTTCTT
GGCTTATGGACGCCGTCGACACCACTGACCGTCTGGGGTCCGTCGCTCACCGCCGCCTATGACCAGTCTCTCCATGCAGGCATCTTTGCTGTGCAGTCCA
TCCTCACCACGTGGGTGCTTTGGCTCTTGCCGCATCTCGTGCAACCGTCCAAAGCCGTGTCCTCGCCGCATCTCGTGCAACCGTCCAAAGCCGTGTCCTC
GCCGCTCAAGGTGCGGCAGTGGACTGTCCGACGCCCTTCTGTCACCGCCGCCACGATGCCAGCTCTCCACACGGCCAAGACTACATGGTCGCGGTGGGGT
CGCTGGACGATGCACAGTCAGTGGCTTCTCGCGCTTGTAGCTGTGGCGTGGGACAGCTACTGTGTCGTGATGCGACGATCGGCGCCTGGTTGTGACATGG
CACGTGGTCAGCTTTTCACGCTTGCGCCGTGCTGCCTTGTCTACACCAGTCGCAATTGCGAAGCCGTGCCACTGCTGCCACGCCTCGTAGCGCTCCGCAT
TCTCGACTGCGACCACACGATCCTTCCAGCACTCGAGGTACTCGCTGTGGCGTTGATCAACTGCACTACAACCGACACCACGTGGGCGTCCTTGACGCCA
ACGACCACGTTCATCTCGCTTCGGAACGTGACGCCGCACGACGCGACGTTTCCGGTCGCGCTACTGCGCATGCTGCACGTCCGCGTCGAGAGCAGCACCG
TGATGCAATGGCCGCGCGATGCCGTCCGCAGCCTCCTTGTGACGCTCGACGTGGCCGACACGCAGCTGCCGTTTCCGCCGACATACATACGCTTTCCGCA
GCTCGTTGGCTTGCACTTTGTCAACACGAGCGCGTCGACCATCGAGGCGGTGCGAGAAGACGACTTCGCCGCCTTGCAGCTCCTCAACGTATCGCGAAAC
CCCTTGACGACCTTGCCGCCATCGGTGTGGCAGCTCCCACGCGTGCACACGGTCGATGTACGAGGTACGCAACTGTCGGCGGTGCCTGCACGGTTCTCGC
CGTCGCTTCGGCTTATTCTGGCAACGACGACGCCGCTGTGTGCGGGGGTTGCAGCCTTTTATGCGTCCCTTCAACCGACGCACCTCGGTGTTTCCTTTGC
CCGCTCCGACGTCAGCTTGATTCAATGTCAACCCCACGCCTAA