Transcript Name :
Sapdi_VS20SDRG_00035
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5920.7818
InsideOutsideTMhelix
310-345
1-286
287-309
NN-scoreoddsWeighted Score
0.72.3070.005
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        1112 bases(100 bases per row)
GCCATGTTCAAGTCCCTCATAAGCGTAAGCGCATGGCTCGGCCTCGCGCTTGCCTCGCGCCCGGCAGTCGTGCTCTACGAATTGCCTCAGTACCTCGGCC
AGTCGGTCGCCGTCATCTCGTCCGACGACGCGGCCAGCACGCTCGCCCAGTGGAAGCGCCCGATCTTCTCGATCGTCGTCGATCCCGCGATTGAGTTTGT
GACATACGATGACGCCGGCAACTCGGCCGTGTGGCACCACTCGACGTCGCTGCTTGGCAACTGGCCCTACAAAATCTCGTCATTCAAAGTGCAACCGGCG
ACCGCGAACACGACCACCAATACCTCGTCGATCCAAGCGCCGTGGAGCTACATTGGCTCGGGCGAAGGCTACCTCATGGTTCGTAACTCGAGCTCGAGCG
CCGGCCAGCCAGAGTGCTACTCGAACGACGGTGTCAACTGCGTCACCGCCACAAGCGTCGCCGACCTCCTCACGGTGCCCACCAAGCTCGACGTGGCTTT
GTACCCTGCGCAGTGCGGCGCCGACCGCTTCATGCACTGGGGATCGACCGGGTACGAGTCGGTATCGGCGTGGTGCTACCTCGCGCGCGAGGCCCTCGCC
ACTGCGCCGCTGCCTTGGGAGTGCGTCCAAGGCTCCAACGGCTGGGTCGCGCTCGCACCCAACAACTCGCTCTGTGTTTCGACGGGCGCCCGGGGTTGCG
TTCAGTTTGCATCGCAAGCGACCTGCACGGCCTCGACGACGATGCTCGCTGGGCCTATCACCGCCGCTTGGACGTTTGCGTGCGGCAACCTTTCGGCGTG
TGTCGGGTCGTCTTCGTCCACCGGGTCGGGCACCGGGTACCCGTTCTGGACTGCGAACACGGGCAGTGCGTCGTGGAGCATTGCATGCGTCGGCGCAGCC
TTGGCGCTCTGCGGTGTCTTTGCGATCTTTAGCCGCTCGACGACGCCGGCCGCCGTGAACGTGGAAGCCACATACTGCTCGAGCGTCGGGGATGCCGAGA
CCGACGACGATCTCGAGTCGGTGTACCGCACACCGGTCTAACGCTCGCGCCGTACTACATCTAGCAACCTTACTAATCTATCTATTTAGTCAATATCTTC
ATCATGTACCCA