Transcript Name :
Sapdi_VS20SDRG_00001
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-70
NN-scoreoddsWeighted Score
0.8895.80.012
*** None ***
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        213 bases(100 bases per row)
AACGTCATTTTCCCCAGCGGCACGCTCGACCCGTGGTCGGCCCTCGCCCCCGACAACTCGACGCACCTCGCCAACCCCAAGTCCAAGGTCGTCTACATTG
AAGGCACGTCGCACTGCGCCGACATGAGCGCGCCACGCCCGACGGACTCGGGCCACATCGTCTGGGCCCACCAGCAAATCGAAGCCGCCGTCGCCAGCTA
TGTTGGCAAGTAA