Transcript Name :
Phyag_g8499
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5150.70221
InsideOutsideTMhelix
1-166
NN-scoreoddsWeighted Score
0.8785.2490.01
*** None ***
TypeScore
endoplasmic reticulum333
GO
*** None ***
*** None ***
*** None ***
Sequence
        501 bases(100 bases per row)
ATGCGGCTGACTTAcgtagtgctgctgcttgctgctacGCTCGTTTCAACCAGCGATGGATTAACAACGGCTGCTGACTCGAAGAAGGTCGAGATGCTTC
aggagactgcagctgtgCGATCTCTCAGAACTCACCACACTGTGAAGATAACTGCAGacacagacgacgaagagagagcgaTTTTCACGGGGCTCAATGG
CAAACTGGAAAAAGTGGAAAATGCGATTGAGATGCAGAATATGGCGGCGCACGGCGGCTTCAAGATTCAGGAACTCGGAAAGGTGGAGGACCTCGTGAAA
AATCCTACGTACGCGAAATGGCTAAAGGACGGAGAAACGCCAAAGACCATCTACAAGCTTTTGGAGTTTGAAGGGAAGGGGCCGGTTGTTATGAAAGACC
CGCGCTACATTGAGTACCTGGAATTCGCAAAGCTGTGGCGAGCGAAGAAGGGTACGCTAGCAAAGGAGTCGTGGCAGTTCTGGAAAAAGAATGCATGGTA
A