Transcript Name :
Sapdi_VS20SDRG_00019
Orientation:
(-)
Number of Exons:
3
Description :
Ras-like protein Rab-11B
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Small GTPase superfamily7.3PR00449
Small GTPase superfamily7.3PR00449
Small GTPase superfamily7.3PR00449
Small GTPase superfamily7.3PR00449
Small GTPase superfamily7.3PR00449
Profile scan predictionP-Valprediction_id
Ran GTPase33.557PS51419
HmmSmart predictionP-Valprediction_id
Small GTPase superfamily, Ras type1.3SM00173
Small GTPase superfamily, Rab type4.1SM00175
Small GTPase superfamily, Rho type8.8SM00174
Ran GTPase3.9SM00176
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-332
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
intracellularGO:0005622IEA
membraneGO:0016020IEA
intracellular protein transportGO:0006886IEA
protein transportGO:0015031IEA
signal transductionGO:0007165IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        1163 bases(100 bases per row)
ACTGAATCCAAGTCAACGCGAGAAAATGGGGTGGTCGCGATCGGGCCGCATCATCGAATTTGGTCGGGCGATGGCCGAAGGAGGAAGAGCGACGTCGCCG
CCCCCGCCGCCGGCGGCCATGGCCCACACCAGCAGCTCCATGAGCGACGTCTCTTCCGCGGCCGGCGAGCAGGAGTATGTGCTCAAGGTCGTCCTCATCG
GCGACTCGGGCGTCGGCAAGAGCAACCTCGTCCAGCGCTTCACCAAGAACAAGTACAACGAAGCGAGCACGCAGACCATCGGTACGTTGCGCCCAATATG
GCGTCGCCTCTAAGAACGTATAGGCTTTGAGTTTGCGGCCAAGACCATCCGCGTCGGCGACCGCCGCATCAAGGCGCAGATCTGGGACACGGCCGGCCAG
GAGCGCTTCCAGTCGCTGACGGCCGCCTACTACCGCAACGCAGTCGGCGCGCTCATCGTCTACGACATTACGAACCGTGCGTCGTTCGAGCATGTTACGC
ACTGGCTCGCGCAGATCCACGAGCACGCCCATGAGAACGTCGTCTTGATCCTTGTCGGCAACAAGTGCGACCTCGCCCACCGCCCCAACACGCGGTACGT
ACATGCTTGTTTTGCCGACCTCTGTGTCTGATGGCACTTCTTGCAGGCAAGTGTCGACGCTCGAGGCTGCTCGGTTCGCCGAGACGCACCACATGGAGTT
TGTCGAGGCGTCGGCGCTCGACTCGACCAACGTCGTCGAGGCCTTCAAGCGCATCATCGTTCCCGTCGGTCGGCTGCTCATGCCGACCAACACCAACTCG
ACGCCGCGGTTACCGCCGGGGTGGCGGCGCGTGCTCTCGCGCACACGACCGGGCGAGTACTCGTACGAGAACCAGTACACAAAGGAGCGACTCGCATTTG
CGCCCAAGGAGGCGGCCAAGCCATCGCAGTACAGCTTCCAGCATGCGGCGCGCAGTGCAAGCTCGGGCGGCAGCAACAAGAGTCTCCAGGGCCCCGCAGG
CGTCACGGTCACCAAGGAAGCTTTGGAGCGCCAGCATCAAAAGGCTTTTCTGGCCCAGCAGTCGGCGTCGCCCAACTGCACGTCGCTCTTCTCGGGCGCG
TGCTGCACGATCCTTTAACCCGTTTTTCTAATATAAACCCGTCTCACATTTTGCCACGTCATA