Transcript Name :
Sapdi_VS20SDRG_00025
Orientation:
(+)
Number of Exons:
5
Description :
TKL protein kinase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Serine-threonine/tyrosine-protein kinase catalytic domain2.8PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain2.8PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain2.8PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain2.8PR00109
Profile scan predictionP-Valprediction_id
Beta/gamma crystallin6.464PS50915
Beta/gamma crystallin7.375PS50915
Protein kinase domain35.75PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain2.7SM00220
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Beta/gamma crystallinIPR001064
Y-scoreD-scoreY-pos
0.7530.85317
InsideOutsideTMhelix
274-585
1-250
251-273
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        1921 bases(100 bases per row)
ATGCTCTGCGCGTTCGTCGCCACGGCGCTCGCTGTCTTTGCTTCTGCAGCCCCCGTCACGGTCTACGATCGCTCCGACTTGAACGGCTACGCGCTCAGCT
TGGACGTAGCAGGGCTCACGAACTTGACAAGCAGCTGGCAAAATGACATCAGGTCGGTCCAAGTGCAGCCCGGCTACGTCTTTGTGACCTACTCCACGGA
ACTTTGCGACTTGCATTTGACGGCTACCAATGCGCTCTTCTACATGGAGTGGATGAGCTCAACACCAACTCTTGGCCGCATCTGGCAAGCCCAGGCCGAA
TCCTACGAGGTGCGCCGGACCAGTGCTACATGAGCACGCACGAACGAAGACGACTACCTCGTCGTTGCGGCGCTGTACACCAACGTCAACTACAAGGGCG
GCGTGCTGCTGCTCTCGACGGGCCAGAAAACACTCAAAAGTGGTTATTCCAACCAAATCTCGTCGATCATGGTCGCTCCCGGCTACACCATGACTGCCTC
CAGTGCCGACGGATCAACAACAACGTTCACGGAAGACTCGAGCAGCCTCAACAGCATCTGGGACAAAGCCATCGTTGCCGTGTCGCTCGCTCGCACCATC
ACCACGACGCCCGTGGTGACTACACTGCCATCGGTGACGACAGCCGCGGTGACAGCCTCACCCCGGCCGACAAGTGCACCCCAGCCAACGAGCATGACGG
TGACAGCGACGTCGCAGCCAGCCGCGATTACGGCGATAGCTACGCTGCAGCCAGTGATCACGACGACCAACGACAGTACGCCGTCCATGACTGGCATGAC
GTGGTTAATGACGTGGCTTCATAGATACGACCGTCATTGTCGGCTGCAGCGCGGCCGTCGTCATCGCCATCTTAGTAGCTGTCTTCTTCGTTTTGCGATC
CAAGAAGAACAAGAAGAAGACGACCTCCATCAGCCTCGTCGAGCCCTTCATCTCGACCAACCAACAGCGCAACCCCAACGCTGGCCTCATCGACCTCAGT
GGCCTCTACAAGGTCCGCCTCGACCAAGCAATGCTGCACCTCGACTGCGTCCTCGGCTACGGCTCGTTCGCAGCCGTCTCCAAGGGCTCCTACAACGGCA
TTCCCGTTGCTGTCAAGCAACTCCAGAGCAGTCGGCGGTCCAACGCCGACATTCAGAGCTTCGTCAACGAGATCGAACTCATGGCTCGGTGCATTATCAC
ATCTCTCTACTCTTTCTAAACCAAGGCGTAGGTTCAACTCGGCCCACATCATCAAGCTCATCGGCGCTGCTTGGACAACCCCGATGGACTTGTGTGCGGT
CATGGAGCTCATGGACCAAGGCGACCTCAAGGACTACTTGGCAGCGCATGACGCCAGCGTGTACACGTGGGCGATGAAGCTCGAGGCGCTGCGGGGAATC
GTCGACGGTCTCTCGTACCTCCACTCGCTCAACATTGTCCACCGCGATCTCAAGTCCCGCAACGTGCTGCTGGACTCGGTCAAAGGCGTCAAGATCGTCG
ACTTTGGTGTCGCCAAGGAAGACGTCCAAGGCACCATGACGATGGGTGTCGGGACGTTCCGGTGGATGGCCCCCGAGGTCCTTCTTGAGAGCGCGTACTC
GGTGGCGGCCGACATGTACTCGTTTGGTACGACAACTATCTTGGTGGACTAGTTCTTATTCTTTGCTAAGGCATGCTCCTCTCAGAGTTTGACTCGCACC
ACATTCCGTACCAAGATTTGACCAACCCGACGACGGGCAAACCGCTCGCCGACCCTGCGATCATCGGTGGCGTCTTGAACGGCTCGACCAAGCCGACGTT
CAGCGAGACGTGCCCACTTTGGGTCAAGACGTTGGCCGACGCGTGCCTTCAGTTCCGAGCAGTCGACCGCCCAACGATCTATGACGTGGCAGCAACGTTG
GCCAAAGTCCAAGTGACCTGA