Transcript Name :
Sapdi_VS20SDRG_00024
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RanBP2-type9.597PS50199
Zinc finger, RanBP2-type9.586PS50199
HmmSmart predictionP-Valprediction_id
Zinc finger, RanBP2-type0.016SM00547
Zinc finger, RanBP2-type0.0019SM00547
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1106
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        3391 bases(100 bases per row)
ATAAAGTCCTGCGATGAAGCGAGCGCACGACGACGAGGACGGGCGCCGGGCCAGCGCATGGACCGGCTGGACGCGCGTGCTAAAGCATGTCCCGCTGCTA
AGCTCCTTCCTAGGCGACGAGCATGAGCCCGCGCCGGCGCCGCCCACGCCGACGCGCCGCCCCAAGTCGCCGCTCAAGACGACGCCGCTCTCGCCGGCGC
GCCGGTCGGGCTTCACGTTCGCCCGCATTGGCCTCAGCGACGACCAGCCCGAGACCGAGACCAAGGCCGAGCCGGTCTTTGAGTTTACGCGCAAGACCAA
GACGCCACCCAAGAAGGCCCGCAAGGTGCTCGACTCGAGCGTGCACGACCAAGGCAACGACGACGAGCAGTATGTGCCCGGCACGTACTCGGAGCCTGTC
GTGCGGTACGCGCGCGCGCGCACGGACGAGCCGCTCGTGCCGATCAACTTGTTTGAAGAACGGCCGGCCAAGCAGGCCAAGCTCTCGCGCGGCGCGTTGA
TCAAGTCGTATGCCCTTTCTCGCGAAGAGCGCCGCCTGAAGCGCCCGGCGCCGAGCCGCCTCCTCGCAGCGCAGTCGATGGACGAGCGCCAAGAGCACGC
CAAGGCCGTCACGGACCGCATCCTCGCGACGCTCCAGGCCCTCGAGTCGGACCCGCTCGCGCAAGAGGCCAAGAAGCCGCTCCCGAGCATGAGCATGTCG
TGGAAGAAGTACCATCTCGAAGTCCAAGATAACACGGCGACGACGAACGACGTGGATATGTCGAGTAAGAGCCCCAAGACCGCGTTCCCGACGCAGAGCC
TGCCCATCTTTGCTCCGCAGCCGCCGGTCGTCCAGCCGCCGACGTCCGTGGCGCCGCCGCCCGTGCTCACGACCGTGACCGTTGCCTCGACGCCTGCTCC
GTCGGCGACGCCGGCTCCGGCGGTCTTTGTTGCGCCCAAGCCGGCGACTACCAGCGTGCGCAAGGCCACCGGCAACGTGTTTGCTTTTGGCCTTCCGCCC
AAGGACACGGAGTTTACGTCAAAGGAGTCGCTCCTCAACGTACCTGTCGCGTACGCCTTCTCCAAGCCGCCGTCGATGAAGGTCGCCCCCGTGAAGGCGC
TCACGTCGCAGAAGCCGGCCGTGCAGCCCGTGCAGGTCGTGCCCACGGCGGCCCCGGTCACGTCGCCGCCGACGTTCTCGAAGTCGACGGCACCTACAAC
GACGAGCACCGGCTCCAACCCGCTCGACAAGTTTAAGCAGTCGGCGCCCGGCGGCTGGAAGTGCCCGTCGTGCTACGTCGCCAACAAGGACACGCAGGTC
AAGTGCCCGTGCTGCAACACGGACAAGCCGTCGGCTGCGCCCGTGGTCGCTGCCCCTGTCGCTCCGTCGATTACTGCACCCGTGGCGTCGACGTCGGCGC
CGGCGCCGGCCATGGACAGCAGCAACCCGCTGGCGCGCTTCTTGGTCCAAGCGCCCGGGACGTGGCAGTGCCCGGGATGCAAGGTGCACAACAAGGCGGC
GCAGGCCAAGTGCCCGTGCTGCAACACGGACAAGTCGACGGCCGAGCCTGCCCCGGTGGTCACCAGCGAGCCGGAGTCGAAGAAGAAGCGCAAGGCCTCG
GACGACAGCAACAGCGCGCCTGCCAAGACGACGTTTGCATTCACGGTACCGACGACCGATGCCTCGGCGCCGGTTGATGTCACCGACAAGCCGCTTCCGA
CCTTTGGCTTTAGCGCGCCGGCGGCCAAGACTGCGGACGCACCGTCGGCTGGCTTTTCCTTTGGCATCTCGTCGACCGACAAGCCGACCGACAAGCCTGC
TGCGGGCTTCAGCTTCAGCGCTCCCGCGGCCGACAAGCCGACCGACAAGCCCGCCGCCGGCTTCAGCTTCAGCGCTCCCGCGTCGGAGAAGCCGACCGAC
AAGCCCGCCGCCGGCTTCAGCTTCAGCGCTCCCGCGTCGGAGAAGCCGACCGACAAGCCAGCTACGGGCTTTGGCTTCAGCGCTGCGACGACCGACAAGC
CAGCTACGGGCTTTGGCTTCAGCGCTGCGACGACCGACAAGGCAGCGGACAAGCCTGCTGTAAGCTTGGGCTTTGGCGCGTCGACGGCCGAGAAGCCATC
GACGGGCTTTGGCTTTGGTGCCTCGTCGCCTGCGGACAAGCCGGCGGAGAAGTCCGCGACGGGCTTTTCGTTTGGTGCTGCCGACAAGCCGGCGGACAAG
CCTGCTTTGGGCTTCGGCTTTGGTGCCACCACGTCGGCCGCCAAGCCGGATGAGAAGAAGACGGCAATGAGCTTTGGCTTTGGTGTCGACAAGCCCGCGG
ATGCCGCCGCCAAGCCGGTGGAGGCGGACAAGCCCGCAGAGAAGGCGACCATGTCGTTTGGTGCATTTGGCGCGACGGCCGACAAGGCGACGACCAGTTT
TGGCTTTGGCGCGGCGACGCCCAAGGACATGACCGAGACGCCTGCGGCCCCAGCACTCTCGTTTGGCACGGCGTCCTCTGCGCCGCCTGCCGACAAGGCG
CTTTCGTTCGGTACCGACAAGCCCACGACGTCGCCATCCTTTACGTTTGGCGCCAACAAGACAACGGCAGAGGCACCTGCCCCGTCGACGTCGTTCAACT
TTGGCGCGTCCAAGCCGACCGACTCGTTGGGTGCATTTGGCGCGACGGCCGACAAGCCGGTGACCGCATTTGGCGACAAGCCCACGTTTACGTTTGGCGG
TGCGTCGACCGAGAAGCCTGCGTTCAGCACGCCGGCGACGACGGAAGCGACTCGCAACGCGACCTCGTTTGGCTTTGGCAGCAGCGCCCCAAGCGCCACG
ACGACCTTTGGCGCGCCGTCGTCGGCTTCGGCCTTTGCGTCGCCGTCGCCCACGACCGCCTTTGGCGCTGCACCACCGGCGGCGTTCAACCCCACTGCCT
TTGGTGCTGCACCGGCCGCGACGCCGGCGTTCGGTGCCCCAACGGCGTCAACGGGCTTTGGCTCGTCCTCGGCGTTTGGCAGCAGTGCTCCTGCACCTGC
CTTTAACGCTGCGCCGAGCTTTGGCGCCCCTGCTCCTGCAGCGGGTGCTGGCTTTGGCGCGGCGCCGGCTCCCTCGGCTTTTGGCGCCCCGACGGCGTTC
GGTGGCAACAACAACAGTGGCTTTGGCGCGCCGGCGGCCTCTGCATTCGGCGGGGCCCCGGCGTTTGGTGCGCCAGCGGCCAATGCTTTCGGTGCTGCTC
CTGCGGCTCCGTTTGGCGGCGGCTTCAACGCAGCGCCTCCTGCTGCTGCGGGGGGTTTCTCGATGGGCCAAGCGCCGCCCAAGCAAGGCGGCGGCCCGCG
TCGTATTGTGCGGGCGCGCTCGGTACGCAAGTAGGTAAAACAAGTAATATTAATATAACACGCAGCGGGGTTTGCCCTGTCCTCGGTACGA