Transcript Name :
Sapdi_VS20SDRG_00017
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5570.73519
InsideOutsideTMhelix
325-356
1-301
302-324
NN-scoreoddsWeighted Score
0.5691.1930.002
*** None ***
TypeScore
nuclear304
GO
*** None ***
*** None ***
*** None ***
Sequence
        1304 bases(100 bases per row)
TGTTGGACAGCGTGGTCAACACTCGTCGAAAACGGCCAATCACGGCGCTTCGAAAAAGCATCCAATCGCGATCTCAGATCTGATCGGCTTCAACATCGCC
AGTTTACCTTTCATGCGTCGTATCACAACCGCCCTTCTTTTTCTTCAGAGCGCGTCGGTCGCCGCCGACGTCGCGCTCTTCCCGATCCCGTTCTACCGCG
GCGACGCCGTCGTGGCCTCGGCCAACGTCGGGAACACGGGCGATGCGTGGGTGCCGGTGCAGTCGCTCACGCTGTCGTCCACCGACGTCGAGTTTGTCGC
GTATGCCTTGCCCAACTACGAGGGCTCGTCGACGGTCTGGCGCCGCAACACGAGCTTTATCAACAGCAGCGCGACACCGATCGCTTCGTATAAAGTACGT
CCGCGCACAGCAGCTACATCTCTCAACACGACATCGAACAGCAGCAACTTGACGCTGTGGAGCTACGTGCCGGTCAGCGACGGCCGATCCACGTACTACT
ACATGGTGCGCAACTCGAGTACGAGCGCCGGCAACCCCGAGTGTCACTCGACCGGCGGCGTCATCTGCGACAAGCAAGCGTCCTTGGCCTCGGCCGTGTA
CCTCGTCAATAGCGTTCTCGACACGGTGCAGTGCGGCCCGGCTTCCGGCATTGTGGGCGGGACGCCGTGGAGCGAAGACCCGACCTCGGTCTGCGCCGCC
GCCCGCGTCGCCTTGCGAGAGAGCTACGAGGACCGCCCTCTCTACAAGTGCATGGAGGGCACCGCTGGCGTCGTCGGCCTCGTCCTCAGCAACAGCTCGA
GCGCAATGGAGTGCGTGCGCGACGTGCCGGCCTCGACGCGCCGCTGCACAACCTTTGCCCGCCAAAAAGAGTGCAACACCGCTCTCACCCACCTCATCGG
GAACGTGACGGGCCTCGCGACGACCATCTGCGGGGACCCGACCTCCTGCCTCTCGGCGCGGCCGACAACGGCGCCGTTTACGGCCATGCCCGCGCGCCAA
GGCGACGGTACATTACGCTTGGTTTTGCGCCGGTTGACTCATCCTGATGCGTAGCGCTCTCGTGGCAGGCGGGCGCAGTGTTTGGGGCCACCGGTGTGCT
CGCGATCCTCGGTCTCTCGTACGTCTTTGGCCCGCGCCGCGCGACACCGAACGTCAACATTGAGGCCACGTGCACGTCGAGCTGCGCCGACGATGAAGTC
AACGAGACACGCTACGTCGCGACCGTCTAAGGCAGCATCGGCTCTCTGTTTTTGCGTAACTTATCCTCTTCTCTGTTATAATCGAGTGTATATTGTGCTA
CCCA