Transcript Name :
Sapdi_VS20SDRG_00027
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
61-72
133-138
237-271
360-379
440-447
1-37
96-109
162-213
295-336
403-416
38-60
73-95
110-132
139-161
214-236
272-294
337-359
380-402
417-439
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1553 bases(100 bases per row)
GCTAGTTACTCACGCGTCAGTGGCCAGTGCGCAGGGACTCGTGGCGACGCGACAGCGACGGCTACCACTTCAACAAGTAGCTCGGTGTCCGATTATACTG
CGATGGTCGAGGCTCACACGGCTTTAGTCGCTCTCGCCGATGGATCCGAAAGCTACGACTACAGTGCTGTACGTGCGCGCCGAGGACCTTACGGACGACG
TCGACGTCATGCCCGCCTCGGTCCTCGACGACATTCGCCTCCACACGCGCTTCATCTGGTGGTCGCTGCTCTTCCTCAACGGCAGCTGCCTCTGGGCCTA
CTACTCGTGCTTGTCGGCGCAGACGTACTACGCCGCGCGGTTTGTCAACACGACGTTCCGGTTCGAGTACCTCACGACGCCGATCTCGACATGGCCCATG
TTCCTCGGGCACTTGGTGCAAGTGCTGCTCGGGCTCGACTCGAAGCTTGGCGTGCTCTGGCGCGTCCGCGTCGGCTACAGCCTCTACCTTCTCTCGGCGC
TCGCGATCGTCCTCCAAGACGTGTGCAATGTGTCCCCCGACGTGGGCGGTCGCATCGTCTTGGTTGCGTTTGGCACCGTCGGCTTTTCCAACTCGCTCAC
GGAAGCCACGTTCTACGCGCTCTCGGCGCTCTTCCCCGAAGCCATCTTCACCAACGCCATGCAGCTCGGCAATGGCACGTCCGGCATCCTCAACATCTCG
CTCAACACGCTCATCCAGCTGTGCGTCGGCGGGCTCGATCCCCCGACGCATGCACTCCACGAGATCCAGCAGGTCTCGTTCTACATCTTCTTCAGCATCT
TTATGCTGGTCTGCTTCCTTGCGCTCATCGTGTACCACGAGCTGCTGCGCATTCCGTCGCTCATCTACCTGGTCGCGCGGACCAATGCGACGACTGCGTC
CCGGCGCGAGGCGCTGCCGGCGACGTGGGCCCGTCTCGGGCGCATCACCCACGTGCTCTTTCTGCCGCTCGTGAGCCAGTGCCTCATCTTCGTCGTCTCG
CTAGTGAGCTTCCCCGGCATTGGCATCTCGTCCGGGTACCAGCTCGCCAACGGTGCGAGTTGGGCCAACTGGTATGTCAATGGCGTGCTTCTGAGCTACA
ATTACGGCGACTTTGCCGGCCGCATGCTCGCGCCCAAGCTCTACCCGTACTTTACTCTGCACTCGTGCTTTTGGTGGACGATCGCGCGCGGTTTGCTGTT
CCTTGCGCTCCTCGTGGGGCTGCCTGGGGACGGCCATAACCCGCTGTACCTGCTGACCGAGGCGCACGCCTTGAATGTAGTGTGGCAGCTGCTCGTGAAT
CTACTCCTCGGCCTCTCGACCGGCGTCCTGAGCACGATCACGATTGGCCTCGGGCCGCGCTTGCTGCCCCAAGAAGACCGCGAGTCGGCCGGCGCCATCA
TGTGTCTCGGTCTCTTCCTCGGCATTTCGTCTGGCGCGACCATTGGCCTCGAGATTGGCCAGCGCCATTGGCTTGGCGCCTAGTCGATGCGTTGCTACGT
GAGTGTACATGATGTCTAACTAACTTTGTATAAAGTCGGCGGTTTATTTGGGA