Transcript Name :
Sapdi_VS20SDRG_00052
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-55
116-121
193-204
262-287
348-353
414-419
485-503
79-92
145-172
225-238
311-324
377-390
443-461
527-543
56-78
93-115
122-144
173-192
205-224
239-261
288-310
325-347
354-376
391-413
420-442
462-484
504-526
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1676 bases(100 bases per row)
ATGCAGCGCGCTTCCGACGTGGCTCTTCGCTACTCGACTGCGTCGATCGACAAGCTCAATACTGAAGCGTACGTCGGCGTGGCCACCCCGAAAATTGACT
TGGAAGGCGGTGCACTCCGCGCCGGCGGGCCGCCCGTCTACACGAGTCGAGAGGTGCTTGCCCTCCTCTTCCAGTATGGCTGCGCTGGCATTCTCTTGGG
CGGCTTCAGTAGCATCAGTTACCCGCTCTTCACGGGCTACTTCCATATGACCGGTGCGCAGTCCAACTCGGTTCGGACGCTTATGGGCCTTGGCTGGACG
TGCAAGGTCTTCTTCGGCCTCCTCACCGACTGCGTTCCGATCTGCGGCTACCGTCGCAAGTCGTGGATCATCATCGGGTGGCTCTGCTGCCTTGCAGTCA
TGCTTGGCATCGCTTGCATGGACCTCGGGCGTCCGTACTACGGGGACCCAGCGCTTCTGGACATTCCGCCCGAGAATCTCACGGCCGCCGACCTCGCCCA
AATCAACGAGTCGGCGCCGACGACGGGGGGCACGCTCGCGATCCTGATCGGCCTTGCGACTGCGTTCTACGTTGTGACCGACTCGGCCGCCGACGGGCTC
GTCACGAGTACGCGCAGCGCGAGCCCGCGTCGGTGCGCGGACGCATTCAGTCGCTGGCGTACGCCGTGCGGACGGGCTTTTGCACGATCTCGATGGTGAT
TGTGGGCGTGTGCATGAACTCGCCGCGGTTTGCCGGCAGCTTTGACTGGGACTTTGGCGTCAACACGATCTTCATCGTCTTTTGCGCGCCGTGCGTGCTC
ATGCCGCCCGTGGCTTTCTTTTTCATTCACGACACCAAGATGCCGCCGTTCGACCTGCGGTCGTACCTCCAGCAGACTTGGGCGACGATCCAGCGGCGGG
TGACGTGGCAGCTCGTCCTCTTCATCTTCTTCTCGCAGCTCCTCGGCGGCTACAGCCTTACGACGACCGCGGGCCCGTACGTCATGATGGTGTGGGCCAA
CGTCAAGAACCTCCAGAGCCAAATCCAGGCCATGGCGTATGCTGGTGTCCTCAGTATTGTCGTCGCGATCATTGGCAAGTACGGCACGCACTGGAACTGG
CGCGTTGTCGTCGTCTCGACCACGCTCTCGGTGGTCGTTATTGACTCGATCGTGCAATTCTGCACCATCTTCAACGTGTGGCGGTCGCCCTATTTCTACT
TGGGCGCGCCGCTCGTCGAGTCGGTGCCCCTCGGTATTCAGTACATTGTCACGACATTTTTGATCGCCGAAGTCGCCGGCGTTGGCAACGAAGGCATGAT
GGTCGGCCTCTTCATGACGACGTTCAACCTCCCGAGCACGGTCGGCCCGGTGCTTGCCAACATGCTCTACGCGTCCTTTGAGGTGGATGCGACTTCGATC
AGCGCGGATTCGATGGCCACCCGATACCAAGTCGCGTACTCGTACGTGATTTACTACGCAGCAATGCTATTGTCGTGCGTTACGGTCGTGCTGCTGCCAC
CCCAAAAGGCCGAGTTGCACCAGCTCCAGCGCGACGCAGGGTCGTACCCGAAGGTTGCGATCGCCGTGTGCATTTTCATTGTCGTCATGTTTGTTGTTGC
CGTCACGGGCAGCGTCCTCTCAATGTTTCCGTCGACGTCGTGCCTCTTGCTCGCGGGCGGGTCGGGCTGCGAGTAG