Transcript Name :
Sapdi_VS20SDRG_00015
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6990.80818
InsideOutsideTMhelix
1-249
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1225 bases(100 bases per row)
AACTCGTTGAAGGACATTCTTTTGTTGTCCATGACACGGAACACGCTTTTTTTTTTCTGCTTCTTATCCGCTGCGGCGGCGGCAGAAGGTCCCTGGCGCC
TCCTCCCGCGCTCGGACGGGTTCGCCGCGGTCCGCCTCGCGACTACTACGACACCCGAGTGCTACTCGGTCGACGGCGTCAACTGCGCAACCGAAACCAG
CATTTGGCTCTGGCCCTCCTTGCTCGCCAGTCCCAACACGACGACGTCCGTGGGCTGCCCTCTCGACAGCGTGGGTCTCTGGGGCAGCGGCGGCTGGTGC
GCCACGGCCAATGCCTCGTTGCACAATACCGCCGAGAGCAGCAAAATGGCATGCAACACCAGCGTCAGCACGATCCTCGCTCTGCGCAAGATCGACAACA
GCAGTACCTACTGCCTCCCTTCGTTCGACGCGGTAGGACCGTGCCAGCAGTTTCCATCTATCGCCTCGTGCGAAGCCACGACCGCGCTACTGCTGCCATC
AGACCCAGGCTGCACGTACTGCCAAACGCTCTGTGAAGCGTCGTGCTTGGGCGTGCAGACGGTTGTCGTCACATCCAGTACGTCGGGTTTATCTGTCTCC
TCATAGACTGGAAGCTGACCATGGAGCTCTAGGCGTCGTGTGGACCGTCGCGAGCGTCGTTGGCGTCTTGTCGTCGATGGTGTTTGCCCAGCGCTACTAC
ATTTCTGCGTTACGGCCAGCAGTCCGAACGAGCGTGGATGGAACGATGCGAGCGAGCTTGGACGCCACAGTCCTCTCGAGCCGCTGTGACTCGTGCACGT
CACCAAGCGCCTTTCGCGAATTCCCGACCCCGTAAGCGAGTGCGATAGAACACGAGGATTTATGTATGAACAATGTTATTTCATTGACAATAGTTCGTAC
GATTCGACTACGAACATACTCGCCAACGTCGTGTTATAGCAAACAGTCGTCAACGAGAAGGTGCATCGCGAATATAGCCCAGCTCGCACAGTCCTCTTTG
CTCTGGGCAAGTAGCTTCCACATTACTGCTCTACAAGCGCGGTCGTGGGAGCGTTGACGTCGCATCAAGAGAGTTGTGACGCAGGCGTCGTGGGGTTAGC
TCGTCCAAACAACTTGAATCACCAAGCCGCCGCAAGCCCTCGAATACTTCGAATATGACGCACCGAGCGTCCATGTATTCACCATCCTTCCCTCTAAACC
AAGCAGAGATGTTGTCCTCGACCGA