Transcript Name :
Sapdi_VS20SDRG_00050
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
43-48
156-167
225-282
358-409
482-482
1-19
72-132
191-204
306-334
433-458
20-42
49-71
133-155
168-190
205-224
283-305
335-357
410-432
459-481
NN-scoreoddsWeighted Score
0.6261.7730.004
*** None ***
TypeScore
endoplasmic reticulum778
GO
*** None ***
*** None ***
*** None ***
Sequence
        1690 bases(100 bases per row)
CTCTGCAAAAAAGCGCGTTGGGTGTCAAATAATCGCCAAGGCGATCTTGGCTTCATTTTGACAGTTGCCGCCTGCCATGGAAGCCCCGCTGGTCAAGACC
GGGCTCTCGACCGTCGACTCGACGGACGCACAAGCCATGGGCGTCAAGACGTTCGGGCCCGTGCTCACGGTCGCGATGGCGCTCAACTATATGATTGGCA
CGGGCTGCTTCGGGCTGCCGTACGCCTTTTCGATTGCCGGCATTGGGCTCACGTCGCTCTTTGTCATTGTCGGCTACATGGGCGCGCTCGTGACGCAAAA
CTACACGCTCGAGGCAATGGCCCGCGCGGACGGCGTCGCGACGGCGGCGCCCGGTGCGCTGCCGCTGAACCGCCTCACGTTCAACAAGTACGGCTTCTCG
CGCATCGGCGAGATTTTCGATGGCAAGCGCGGGTACGTGACGGTGCAGTCGGTGCTCGTCTGCTACTGCCTCGGGTCGCTCTGGTCGTATGCGAGCATCT
TTGCGTCGTCGACCGCGTCCGTCTTCTACACGTACGTCCTCGACGACGTCTGCGATGTGTACGCACCGCACACGACCCTCGGATGCATGGAAGCGTACTA
CATTTGCATGTTCCTCTTCACCGTCATGACCATCACGCTCGTGCTCATGGACCTTGGCGACCAAGCGGTTATCCAAAAATTCTTGTCCGCCTACCGCATC
CTTGCGTTTGGCATCATGTTTGTCACGATGGCCTTCAAGCTCAGCGTCGACGGTGCGAGCGCGGTTGCGGACCGCCTTGCCGCGCGCGAGCACTGGGCGT
TCAACCTGCGCAATTTTGGTGCTGGCTTTGGCCCGACGCTGCTGGCGCTCAACTGCCAGTACAACATGCCCGACTTGCTCCAGCCGGTCGAGTTCTCCAA
GAAGGGCCTCGTGCGCCGCATCACGTACACGTCGATTTCGATCTCGGCGTTCTGCTACTTCCTGCTCGGTTTCCTCGGCTCGATCGCATTTGATTCGGTC
AACCCGCTCGCCACGTTGATGTGGACCGACTTTTCCGGCTGTGGCAACGGCTGGTCGGTGTGCGAGTCGGGTCGCCCGACGTGGTACGGCTCGGTCATCC
ACATTATTGTCGTCATGTTTCCTGTCATGAACGTCGCGTCGTCGTTCCCGATGATTGGGCTCACGGTTGCCGGCAACATTCTGCCGTCGCTGCCGAAAGC
CATCACGGCACCGCTTGGCCCGCGCCGGACCCAGGACTTTTCGCGCGTCCTTGCGGTCACGCCACCGCTCTTGCTTGCAGCGATCTTCAAGAAGCTCGAC
GCGATCTTTACGTATGCCGGGATCCTCGGCTTCGCCATTGGTCTCATCATCCCCGCTTGGTTCCAAGTCGTGAGCGTCAAGTACTGTCGCCGCGTCTACG
GCAACACTGAGGCCGAGAAGACGCCGTTTACGGTCCCCGTCTTAAGCTCGCTTGCGTTCTCCACCGGGTTTCTGTATGCGATGTTTGTGGTCACGTTTGT
CGCTGTCGTGTCGCTTTTTGCTTGATTTTGGAGAATTGATTCGATTATGACTCGTGGAATCCCTGCAGAAATGCCAGATGCCAAGAGTTCTGAGCTAAAT
ATCGTGCTAGGTCGATGCGGCTGGCTATAAGTACTGAGCTGTCTACAAGATCTATAAGGTTGGCGGAATAAGATTGGAGCTAAGCTTATG