Transcript Name :
Sapdi_VS20SDRG_00014
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-75
391-423
99-367
76-98
368-390
NN-scoreoddsWeighted Score
0.6961.120.002
*** None ***
TypeScore
mitochondrial478
GO
*** None ***
*** None ***
*** None ***
Sequence
        1802 bases(100 bases per row)
ACGACACACGACAACGACGCTGCATCGGAACCAACAGATCAGGCGTCGCGGCCTCGATCACTGCTCTTGCCACGCCCTGCTGCGGTGTCGGTGCGAGCTC
GCGGTTGGCTTGGGCCATCGAAGCCAGCGTTCTAGTATCGAACGCGTAGAGTCGGTGTTGATACAGGCGCCGAGGTTGGCGCGCGGAAGTGGCGAAAAAT
TGCGTCCCAACGACCAAGGCGGCGCGTCCGGCGAACTCACGCCTTGCCCTGGCGCTGTGCCCAGCCTCGTTGACGATCGGCATTCCGACCTGTCTTCAAT
TCGCTTGCATCGTCCTGCTGCGCTATGAAATGCCGTCAATTCGTGCCGCTGGTTGCTAATTCGTTACTGGGTACGCGAATCGGGGCTGGTGTTGGGACAC
GAGGCGCAAAATATGCCTTTTCGCCGCCGACATTTGCGTATATAATACCGTTTGAGTGTCCCAGATACAATCTCCAAGTGATAGAAACACTCGACAGGCG
AGAGGCAAGTGCGAACATGCGTCGACGCCGGGGTGACCCGTCCTTCCCGCTGCCATGGCGCGCGCTCGTGCTCATGCTCATGCTGGCGCTGCCTGCGTAC
GCCCAGGTGACCATCTTCGCGCGGCCGGGCTTCGTCGGCGAGCGCCGCGACCTGCCGCTCGGCGCCAAGAGCAGCGAGGTGCTGCCGGACTGGAACCAGT
CCATCTCGTCCGTGGCCGTCGTCGCCGGCTACGAGTTTGTGACCTTTGATGGCCCGGATAGCCAAGGCAACATGGCTCTCTGGCGCTACAACACGTCTGT
CATGGGCCGCTGGGACCGCAGCGTCGAGTCGTTCCTCGTCCGGGCATCAACCGAGTCGACCGCGCTCTCGGCCGTGACGGCCAACTGGAAGTGCATGGAG
CGCGAGCCGCCGACGGCACCGACGCTCTACATGCGCGTGGCCATCGTTCCCCAGAGCCACGAGGTCGGGTGCTTCTCGACGGACGCGGTCAACTGCGTCT
TCTACAACACGATGGCCGACTGCGCGGCGCGGATCACGTCGGTCGCCACGCTCCGCGCTGCGCTCTGCGGCGCGACCCACATGAGCTTTTGGGGCAGCAC
GGGCTACGAGCAAAACACAACGTGGTGCTCCGTGGCCAAAGCCATGTTCATCCGCAACGCGACCTCGACCGGCGACGTGCCCGCGTCGTTTCTCTGGCAA
TGCTCGCCGATCAAGAACTCGTGGATCGCGCTCCGCGTGCTGAGCCCCAACCAGTGCTACTCGACCGACAGCCGCCTCTGCACCCCGTTCGGGACGCTCG
ACCAGTGCCAGGCCAGCATCCAGGGCATGGTCGACTTTGCGAGCGACGAGTTTGTGCTCACTTGTTCCTCAATCGCCCAGTGCGTCATGGACGCCCAGCG
TCCACGCGAAACGCCGGCCGCGGCAGGTATCTATCTATCCAATTGGTATTATCGTGGATCAAAAGTATCTCATGTTTCGGATAGTCAATTGGCCGTGGAT
CATTGCCGGCGTCGGGCTCTCGCTGCCGGTTTTTTGCGGCCTTGCGGCCTGGCACATGCTGCGGAAGAAGCCGCTGCCGACCAACAGTCACATCTTTGAC
ACCGAGTCGACGCTCTGTTCGAGCTACAACAGCGAGCGCTCGCAAGCAATCTAACCTCCTTTGTCGTACCACTGCGCGCCCGTTCGGACTGAAATGATGG
GACCGAAGCAGTCCGCCTCCCCTCGCCCTCTCAATAGCCAGGATAATATATACCTTTAGTGTACCTGTTGATACATAATGTCATTTTGGTGCCCAATCGA
CA