Transcript Name :
Sappa_CBS223.65SPRG_16920
Orientation:
(-)
Number of Exons:
2
Description :
A disintegrin and metallopeptidase domain 1a
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Blood coagulation inhibitor, Disintegrin3.5SM00050
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Blood coagulation inhibitor, DisintegrinIPR001762
*** None ***
InsideOutsideTMhelix
1-497
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1541 bases(100 bases per row)
ATGAAGGTTCGCTTTGGAGTCTGCCTCGCTATGGCCATTGCCGCCCACGCCAACACCCACAAGAAGGGGGCATCCGTCGCGTCGAAGCACGGCGTGGAGG
CCACGACGGCGTCCCGCATCCTCGCTGCTGCAAACGGTGAGTCAGCGTCGTCACTAAACCAGGAAGAAACCCACTGCTGGCATAGATCACAACACGGAGT
ACGAGCCCAGCTTGATTGATGCGTTCGATGAAGCCGACGCGATCAAGGACACGCCATACGACTTTCTGAGCGCCGCCCAAGCGTCTCGGTACCGGTCGAC
GCACGACGACCACGCGCATCACGGCCAGTACTGGGACGACGTTCACGTGGAGGTGATTGCCGACGAAGACGGGTGCCCCGAGATTCCGTGTCGCGAACTC
TCGGACTTTGTGAATGGCAAGTGCACGTACACGCCGCTGCCGCACGGCACGCTCTGCCCGGGCCAGAGCTGCGACAACGACGGTCCGTGCGACGCTGACG
AGAAGGACTATTGCGACAGCGACGGCACGTGCCTTAACGGCTACAAGGACCAGAGCATCGTCTGTCGCAGTGCCCGCGACGCCTGCGACGCGGCCGACTA
CTGCAGTGGCGAAAGCAGCGAGTGCCCCGACGACGAGTTTGCGCCGTCGTCCAAAGTGTGCACCAAGATGGGCAAGTCCACAGGGGGCCCGTGCGACGCA
CCCGACTACTGCGACGGCCGCGGTCACTGCGTGGACATGTACCAGTCCAACAAACACGTTTGCCGCCGCGCCGCCGACGTCTGCGACGAGGCAGAAACGT
GCACGGGCGTCAGCGGCGACTGCCCCAGCAACAGCTTTGCACGCAAGGGCATCGAGTGCACCTCAATTGGCAAATCGTCGGGCGGCGCATGCGACAGCGT
TGACCGCTGCGACGGGCACGGCAAGTGCATTGACCACTTTAAGGGCACGAACCATCTCTGCCGCAAACCAGTCGACGTTTGCGACGAGCCCGAGTACTGC
TCGGGCGAGTGTGGCGTCTGCCCCGACGACCTCGCCGCGCCCGTGGGCAAGGTCTGCACCGAGATCGGCAAGTCGAGCGGCGGCAAGTGCGACGGTGTCG
ATGTCTGTGACGGGCGTGGTCGCTGCATCGATACGTTTCTCCACAGCAGCGTGGTCTGCCGCCATGCGAGTGATATTTGCGACGTGCCCGAATACTGCAC
GGGCTACGTCGGCAAATGCCCCCACGACAAGTTTGCATCCCGAACGACCGAGTGCACGCCGATCGGAGAGTCGTCCGACCACGCGTGCGACGGCGTCGAC
TACTGCGACGGCCACGGCAAGTGCGTCGACCACTTTGAGAAGGACACGCTGTGCCACGTCGCCGAGGACCTCTGCGACACGAACCTCTTCTGCAACGGCG
CCCACGCCTCGTGCCCCCGCAGCACGCACGACACACACGACTTCGGGAACGACTACGCCTCTGTCTTTGCGTACAAGGCGCGTCAGTGCTCGGCCAAGGC
AGCGCAGCAGTTTGTCTCGGTGTACGATGCGCCGGGGGGCA