Transcript Name :
Sappa_CBS223.65SPRG_14273
Orientation:
(+)
Number of Exons:
6
Description :
dynein heavy chain
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain0.24SM00382
AAA+ ATPase domain0.99SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
KO ID
K10408
Cluster Id
6
Sequence
        13683 bases(100 bases per row)
ATGAGCTGCAATAGCTTCGACGAGACGGAGCTGCTCGTGGCGTGGATCTGTGAGCGCATCCGGCTGCCGGGCTACGCGCCAACTAAGTGGTCGCCGGCCG
ACTCGGCGATCGTCAAGGAGTTTGCCGAGAGTCCCAACGTGCCCGCGCTCTTCGTGTCGACGCAGCCGCCCACCGGCGGCCTCCGCGTGAGCACCGTCGC
GCCGCGCGACGCCAGCTCCATCTTTTACTTTGTCAAGAACGGCCAAGTCGCAGTAAAAGCGGCGACCGCCGGCAGCAGCCTCCAGTTCGGCTCGATTTCG
GGCGAAGGCATTGCGTCATTGCTGCAGCTCATGAACACATTCTACCTCCAGCGACTGCAGCACGAGAAGAACTGGCCCGAGTCTGTGCAGAAGGAGTTCA
CTGCGCAGTTCTACCGCTTCATGTCGAGCTTGACCGAGACCGTATCTCGGGGCCTCGGCAAGACGGTGCTGTACCTTCCGCCGATCGCGACCGAGAAGAT
GAACCACAAGGACAAAGACCTCGTGCAGCAGCTCGAGTCGACCGTCATCCACTGGACGCGGCAGATCAAGGAGGTTGTCAACAACCAAGACAACGCCCAC
GATGCGGAAGGCGCGGGGCCGCTCGAAGAGATCAAGTTCTGGGAGCACCGCACCGAGGACCTCTCGGGCATCACCGAGCAGCTCAACCGTCCGGGCGTGA
AAGACATCGTCGACATTCTCAGTTTAGCGAAATCGTCGTACTTGCAGCCGTTTGAAACCCTCAGTCAGATCATCAAGCAAGGGTCGTTCGAGGCCAACGA
CAACCTTCGGTTCCTCAAGAAGCTCTGTCCGATCTGCGAGCAGATGGCGAAAGCGACGCCGAGCGAGATCCCGGCGCTCTTGCCCAAGCTCCTGACGTCC
ATCCGGCTCATTTGGATGTACTCGCGCTACTACAACACGGAAGACCGCATCACGTCGCTCCTCCGCAAGGTCTCGAACGAGATCATCGCGCTCTCGGCCA
AGACGATCTCGCTACGCGACATCTTTGACGGCGACGTCGTCCGCAGCATCCGCAACCTCGAGGAAACCATCGCATGCGGTGTCGCGTGGAAGACGATTTA
CGCCAACGTCACCAGCGCCGTCCAGCGCGAGGGCGCGCTCAAGTGGCACTTCGATGACACGAGCATTTTCGCGCAGGTCGACGCGTTCGTGCAGCGCTGC
CGCGAGCTCCTCGAAGTCTGCGAGGGCCAGATCCAGTTTGCGCGCAAAGGCGGCGGCTCCACGAGCCTGCCATGCTTTGGCGGCAACCGCGGACTCGAGA
TCGTCAAGTCGCTCATGGGCATCGAGACGCAGTTTGAAGGGCACATCGACCGCCTGCGCAAGCTCGACTACGACATCCTCGACGTCAAGATCACGTTCTG
GCACAGCGACTTCAACGCGTTCAAGAATGGCGTCAAAGACTTGGAGGCCATGACGCAGAATGTTGTCAACGCCGCCTTCGACTCGGTGTCCACCATTGCG
GCCGGCTGCGATCTCTTGCAGGCCTTCCAGACCATCTCCAAGCGCGAAGCCATTCGGCGCTGCCTTGAGAAACGCACGATCGACGTGTATGCCATGTACA
AGGCGCAGATCTCGACCGTTCGGAGTCTCTTTGAGAAGAACAAGGGCGCACCCCCGCTCTCGGCCACGGAGCCGCAGTACGCGGGCGCGGCGCTCTGGGC
GCGCGGCCTCCTCCTCAAGTGCAAGGAAGATCTCATGCGACTCTCGCAGCTCACGAGCCTGCCCTCCGGCGCGATCGAATTCGAGGAAGCCACGTCGCAC
TTTGACGGTCTCAAGGCCGTGCTGAACGACTACATTCAGAAAAAGTACCACGACTGGATCGACGAGCTCAACGAGCTGGGGCAAGCAAATCTCAACGCGC
GGCTCGAGAACCCCCTCATGACCAAAGTCGGCGCGGAGATGCTCGCGTCCACAGCGACCTTGCCCGCGGCCAACGCCAGCACCAACGCCAATGCACTGCC
CGCCTCCGGCGACGCGCCGGTCGAGAAGCTCATCGGCCGATCCAAGAAAGGGTTTCTGCACTGCAATTTTGACCGCCCGCTCCTCCAGCTCTTCGCCGAG
GTGCACTATTGGCTCTACTTTAACGGCGAGGTCCAGATCCCGTACATCGCGCACGACATTTGCAACCAAAAGGAGCAGCTGCGGGTGCTGCGCGAACACG
TCGTGCTCGTCATCCGCGACTACAACCGCATTTTGCACGAGCTCTCGTCGACCGAGCGCCGGCTCTTCGACGACATCATCCGGAAGCTCGACCGGCGCAT
CCAGCCCGGGCTCCAAAAGCTCACGTGGCAAAGCAAGGGCATCGTCGACTGGTATGTGGCCGACTGCCGGAAGCACTGCGACACGACGTTCCGCATCGTT
CGCGAGTTTCAGGACAATAAGGAGCTGATTGCGAGCAACTGCAAGATGATAGCGGGGCTCATGCACATTGCGATCGAGCGCAACTCGGTCTACGACGACG
GTGTCTTTGAAGTCAAGCAAGCGAGCCATCGAAAAGAGATTGAGAAGAAGCTACGGGACGCGTACGAGAGCATCCGCAGCACGATGGGGGCCATGTACAC
GCACTTTGCAAGCGGCCCGCCAGACGTCCAGCGCGAGTGGGCGCGGTTTGTCGAGCGCGCGGACAAGAGCCTCGAGGACGCGCTTCGGCAGAGTGTGAAA
AAGTCGCTGCAAGAGCTCAGCAAGGCCATCAACGGTGACGCCAAGACGGACCCGCACCCGCTCTTCCGCGTGCACGTGGTCCTCGAGGACGGCCGCGTCG
AGTTCCACCCGCTCATGGCCAACCTCACGCAGATGGTCAACACGGTCGCCAAGGAGATCTTCAACGTCATCTCGGTCGTGCCGCGGCTCACGTCGCTGCT
GACCAGCACGACAGAGCCGCATGTTATCGACGCGCCGGGCGTCGAAGCCACGTTTTACCAGTCGATCTTCCAGGACGAAGAAATCCTCAAGGTTCTCGTG
CACATCATGAACGGCATGTCGGCGAGCGCGACGGAGCTGCAAAAGTACCTCGGGTACTGGGACAAGTACAAGCTCTTGTGGAACCAAGACAAGCAAGCGT
TCATTCGGCGCTACGCCAAGGCCAACCGCCCGCTCTCGCAGTTCCGCGTCGATATTGAACGGTATCGGGAGCAGCAAGTCTCGATCACAAACGAAGACCT
CACCAACACGATCAATTTCGTGCAAATTGACACCAACTTGCTCAAAGCGAGCCTCGTCGACCATACGGTGCAGTGGATCGGCAAGCTCACGGGCCTCCTC
AACCAAACCGCGGCCGACGAGCTGCGCGCGCTCAACCTGATGATCAAGGAGAACACGAAGAAGCTGCTCATCAAGCCAAGCAACCTCGACCACCTCGGAC
AGAGCATTACGCTGCTGCAGGAAATCAAGGACTCGGCGCCGAGCGTCGAGGCGCAGTTCGAGCCGCTGCAACAAAAGTACGACCTCTTGGCCGAGTTTGA
CGTGCAAATTTCCGACGACGAGGCGCGGGACCTCGCGGGCTTGCGGCCGCAGTGGGAAGCGTACGAGCTCATGATGGTGGAGGCGAACGCGATGCTGCAA
AAGTGCAAGATGAGCATGAAGCAGTCGCTCCAGGACACGGTCGCGGAGCTGAGCCACCACATGATCGAGCTCCGCAACGAAGCGGTGGCGTCGCTGCCCT
ACTCGGACGTCGACACGACGTCGGCCTCTGCGCATGGAACGCTGCTTGCGTTTGAAGCCAAGATGGAGGCGACGCGCGCGCGCCAGGCAGCGCTCAAGAA
GGGCCTCGACATCTTCGGTATCGAAGAGTCGCCGAACGAGGACTTTGTTCGAACTGAGAAGGAGTTGGAGCTGCTGCAGACGATCTGGGCCATCTACGAC
GAGTGGGACGGCGTCTGGTCGAGCTGGAAGCACAACGTGTTCACGTCCTTGGACGTCGAGCGCATGGAGATGACGGCGGCGCAGTTCTTCAAGAAGATCT
CCAAGGCCGGCAAAGACATGAAGGAGTGGGCGGTCTGGGCGTCCATGAAGGAGAAAATCGACCAGTTCCGCGCGACCTTGCCGCTGATCCAGGACCTCAA
GAACGAAGCGCTCCGGCCGCGCCACTGGGCGATGCTCAAGGAGGAAATGGAAAAGTTCTTTGACGCGACGGCCCAAGACTTTACACTCGAGAAGGTCTTC
TCGCTCGGCTTCCACTTGCACGCCGAGTACATCTCGAGCATGTCCTCGAACGCGTCCAAGGAGCTCTCGATCGAGCAGGCGCTCGATGGGATTGCCGAGC
GCTGGAACGGCATCGACCTCGACCTCGTCGAGTACAAGTCGGTGTACTTTAAAGTGCGGTCGGCCGAAGACCTCTTTACCTCGCTCGAAGATGACCAGGT
GCAGCTCTCGACGATGAAGGCGTCGCCGTTCTTCGAGGCGTTCAAAGCCAAGATCTTGTACTGGGAGGCATCGCTCTCGCACGTCTCCGAGGTCGTCGAG
ACGCTTCTCGGGGTCCAGCGCTGCTGGATCTACCTCGAGTCGATCTTCATGGCGAGCGAAGACATTCGGAAGCAGCTGCCGCTCGAGTCGGCGCTCTTTG
ATGACGTCAACCAGGGCTACATCCGCGTGACGACGTCGATGGCGTCGGCCAAGAACGCTCTCAAAGGCACTCATCTCCCCAACACGCTCGAGACGCTCGT
CGACATGCAGGCCAAATTGGATCAGATCCAGAAATGTCTCGACCAGTACCTCGAGACGAAGCGCATGCTCTTCCCGCGCTTCTACTTTCTCTCGAACGAC
GATTTGCTCGAGATCCTCGGGCACCAAAAGGACCCGGATCAAGTCCAGAAGCACATCAAAAAGTGCTTTGAAGCCATCAAGTCGCTCTTCCTCCTGCACC
CTGGCACGCGCGGCAACCTCACCTTCGAAGCGGCCGGCATGAACGCGCCGGACGGAGAGCAAGTGTTGTACCTCAACAACGTGGTTGTAGCCGGCGCTGT
CGAAATGTGGCTTTTACGCGTCGAAGCAGCCATGGTCGCGTCGCTCCAGAAGCTCTTTGCCGCCTGCCTCGTCGGGTACCGCGGCAAGAAGGACAAGTGG
ATCAAAGAGTTTCCAGGGCAGCTCCTCATCACGTGCGGCCAGACGGCGTGGACAAACGAGTGCATCAAAGCCCTCAACGACGTGTCCAAAGGCGACAAGA
AGGCGCTAAAAACCCTCAAGAAGAAATGGATTTCGTACCTGAACAAACTCGCCGACATGGTCCGCGGCCAGCTCTCGTCGATCGACCGCAAGAAGCTGGT
CGCGCTCATCACAATTGAGATTCACTCGCGCGACGTGATCGACCGCCTCGTCAAGCAAGCGTGCAAGTCGACCAACGACTTCGAGTGGCTCATGCAACTG
CGCTTCTACTTCAACAAGGACCTCGGCGACCACGGAATCTGCGAAGTCAAACAAACGGTCACGTGTCTTCAGTACAGCTACGAGTACCAGGGCAACAACG
GCCGCCTTGTGATCACGCCCCTCACGGACCGCTGCGTGCTTACCATGACGACGGCGCTGCATCTCAACCGCGGCGGCAATCCGCTGGGCCCTGCCGGCAC
GGGCAAGACCGAGACCGTCAAGGATCTCGGGAAGAACCTCGCCAAGTACGTCATCGTCTTCAACTGTTCGGACGGTCTCGACTACAAGTCGGTCGGGCGC
ATGTTTGCCGGCCTTGTGCAGTCAGGCGGCTGGGGCTGCTTCGATGAGTTCAACCGCATTGAGATCGAAGTGCTCTCGGTCGTTGCGCAGCAAGTGCTCA
CAATCATGCAAGCGCTGACGATGAAGTCCAAGGAGTTCGTCTTCCTCGGCACCATGATCCAGTGCAACCACAACATGGGCATCTTCATCACGATGAACCC
GGGGTACGCCGGGCGCACGGAGCTGCCCGACAACCTCAAGGCACTGATGCGTCCGTGCGCCATGATGGTGCCAGACCTCGCCTTGATTGCCGAGGTGATG
CTGCAAGCAGAGGGCTTTCGCGACGCCAAGGTGCTCGCCAAGAAGACGACGACGTTGTACGGCCTCATGATCCAGCAGCTGAGCAAGCAAGACCACTACG
ACTTTGGGCTTCGCAGTCTCAAAGCCGTGCTCAACATGGCCGGCGCGCTCAAGCGAGAGGACCCCAACATGCAGGAAGAGCACATCCTCCTGCGTGCGCT
GCGAGACATGAATGCGCCCAAGTTTGTACGCGAAGACGCCGCGCTCTTCAAGCTCCTCCTCGGCGACCTCTTTCCGTCGATCGAGCTGCCGATACCGGAT
TATGGCGCGCTGCAGAACGCGATTCAGCGCGAGCTCGTGAGCCAGGGCCTCCAGTTGCACCCGAACATTCTCTTCAAGACAATCCAAATGTACGAGAGCC
AAGCGACGCGCCACTGCAACATGATTGTGGGCCAGACCATGGCCGGCAAGTCGACGGTGTGGAAAACCCTCCAGATGGCCAAAACGCTTTTGGCGAAAGA
GGGCGTGAGTGGGTACACCCCCGTGCGCGTCCAGGTGCTCAATCCCAAGTCGATTTCGCTCAACGAGATCTACGGCGTGTACGACCTCGCGACCTTTGAG
TGGATCGACGGCATCCTCAGCGCCATCTTCCGCACGCTCGCGAGCGACGAAAAGCAAGATGAGAAGTGGATCATGCTCGACGGGCCGGTCGACACGCTGT
GGATCGAGTCGATGAACTCGGTCATGGACGACAATAAAGTGCTCACGCTCATCAACGGCGACCGCATCGGCATGAGTCCGTCCATGGCGCTTCTCTTCGA
AGTCCAAGACCTCTCAGTCGCCTCGCCCGCGACCGTCTCCCGCGCCGGCATGGTGTACATGGACGTCGAAGACCTCGGGTGGCGTCCGTACGTGCAGACG
TGGCTGGACACGAGCATCGTCGACGCCGACGAGCGCGAGCTCCTCAAGGCACTCTTTGAAAAGTACGTGGTCAAACTGCTCGCGTTTCGCCGGACCGACG
TCACGGAGCTCATTCCGGTGGCGGAATTTAACGGTGTCAAGAGCTTCTGCAACCTCTACAAGGTGCTCGCGACGCCCGAGAACGGCGTCGAGAAGAGCTC
CGAGGTCTTTGGCGCCATGGTCGAAAAATGGTTCCTCTTCTGTCTCGTCTGGTCCGTCCTCGGCGCCGCCAACGACGACGGCCGCGCCCGCTTTGACGCG
TGCCTCCGTGAGATCGACACGGTGTTTCCACCGGTGAAGACCATCTACGAGTTCTACGTCGACCCGAAGGCGCACGACCTCAAGCTCTGGGACGAGAAGC
TGCCCGCCAACTACCGCGTGCTCCCCAACACGCCATTCCACAAGATCATTGTGCCGACCATCGATACGCTTCGGTATGGATTTCTGCTGCAGACGATGGT
GCTCGGCGGCCTCAATGCGCTCCTCGTCGGCGACACGGGCGTGGGCAAGACGACCATCATCGAGCGCGAGCTCGAGAATCTCTCCGACGCGACGTATGCG
CGCCTCGTGATGAACTTTAGCTCGGCCACGTCGTCATCGACGACCCAGGACGTGATTGAAGCCGTCATGGAGAAGCGCAGCATGAACCGGTTCGGCCCCG
TCGGCGGCAAGAAGCTGGTGACGTTCGTCGACGACCTCAACATGCCAACCAAAGACGACGTTCGTCGACGACCTCAACATGCCAACCAAAGACGACTTTG
GGTCCCAGCCCCCGCTCGAACTACTGCGGCAGTGGGTCGACTACGGCTGCTGGTACGACCGGAAGAAGCAGACGCTGCGGTACTTCGTGGACATGCAGCT
CGTGGCCGCCATGGGACCACCCGGCGGCGGTCGGTCCGTGATCTCGTCGCGCTTCCAGAGTCGCTTCAACCTCGTCAACATGACGTTTCCCGAGAACACG
CAATTGCGCAAGATCTTCGAGACGATGCTCGTGCCCAAGCTGAGCGAGTTCGACGACGAGATCAAACCCCTCGGCGCGCCGCTCGTCACGGCCACGATCG
TGCTCTACCAGACCGTCGAAGCGAACTTTCTGCCGACGCCTGCCAACTGCCACTACCTCTTCAACCTCCGCGACATGGCCAAGGTCGTCCAGGGCCTTTT
GACCGCCGAGAAGCTGCTCATTTCGGGTCGCGACGGCATGCTCCGGCTCTGGATCCACGAGGCCCTTCGCGTCTTTAGTGACCGGTTGACGTCCGCCACG
GACCGCGCGCTCTTCAAGGTACAATCGTCTCGAGTTCGCGTCTCTATAACCTTGTCTAGACCAAACTGGACGAGATCCTCGCGGCGACGTTCCAGACCGA
GTGGAACCGGCTTCTCAACACGCACGTTGAAGTGCTCAAGGAGAGCGGGCCGCTCTTCAGCGGTATTTTGACACCGTCCGAAGACGACGCGCCCGTCAAG
TACGACGAAGTCGACGACATCAAAGGCCTCAAGCATTTCGTGGAAGATCAGCTCGACAACTACAACGTCGAGCCGGGTCTCGTGCCAATGGACCTCGTGC
TCTTTGGTGACGCGCTCATGCATCTGCTGCGCATTTACCGGCAGCTGACGACGCCGCGCGGCAACCTCCTGCTCGTCGGCGTCGGTGGCAGCGGTCGGCA
GAGTCTGACGCGCCTCGCAGCGTTCATTGCGAGCTGCGACCTCTTCCAGATCGAAGTGACCAAGAACTACCGCCCGATGGACTTTCACGAAGACATGAAG
AAGCTGTACCACAACACGGGCGTCCTGAACAAGAAGACGACGTTCCTCTTCAGCGACACGCAGATCAAAAGCGAGTCGTTCGTCGAGGACATCAACAACA
TTCTGAGTTCCGGCGAGGTATCCCGTGTTCAAATCTGGTTGATAGCGCTGAGTTGTACACTAGATTCCAGGCCTCTTTGAGAAGGACGAGCAGAGTACCA
TCATCGACAGCGTCCGGCTCCGAGCGCGCGCGCAAGGCGTCAAGGAGACGAAGGAAGGCCTCTGGGGCTTCTTCATCGGCGAAGTGCGGCGCAACTTGCA
CGTTGTCTTGGCGCTGAGTCCGATCGGGAAAGGCTTCCGCAACCGCGTGCGGCAGTTCCCGTCGCTTGTCAACAACACGACGATCGACTGGTTCGACGAG
TGGCCCATCGACGCGCTCCAAGAGGTCGGTATGAAGTTTCTGGACGAGAAGCGCATTGCGGCCGAGGCCCAGCGGCCCAAGATCGCCGCCGTCTTCGCCG
TTGTCCACAGCTCGGTCGTGCTTGCGTCGGCGCAGATGCTCGCGTCCATGAAGCGCCACAACTACGTCACGCCGACCAACTACCTCGCACTCGTCAAGGG
CTACGTCGTATGTCCTTCGACCCTTTGTACTTGAGTTGGCGAAGTAGGAATTCTGTAGGAATGTCTGCTTGAGAAGAGCTCGGCGATCGTCGACTCGCGC
GACAAGCTCAAGAACGGCCTGGCCAAACTCGAAGAGAGCCGGACGCAGGTCGAAGAAATGTCCAAGCAGCTCGAAGAGCGCAAGGTTGTCGTCGCGCAGA
AGAACAAGGACTGCAGCGACCTCCTCGTCATCATCGTCTCGGAACGGCGCGTCGCCGACGAGCAGCGCAAGCAGGTCGAGGCCGAGTCCGAGCGCATCTA
CAAGGAGGAGGTCGAGACTAAGAAGATCGCCGACGACGCCCAGAAAGACCTCGACGAAGCGCTGCCGGCGCTCGCCAAGGCCATGGCCGAGGTCGACCTC
CTCGACAAGAAGGCGATCGCCGAAGTCAAGGTCTACTCCCAGCCGCCGGAAGCCGTCTCGCTCGTCATGTGCGCGGTCATGGTGCTCTTTGGGCTCACGC
CGACGTGGGCCGTCGCCAAAGTGAAAATGAACGACGTCAACTTTCTCCAGCAAATCAAAACCTTCGACAAGGACTCGATCCGCGACAAGACGATCGCGGC
GCTCAAAAGTACACGTCCAAGGACATGTTCAAGGCCGACATTGTGCGCAAGGTCTCGGGCGCCGCCGGTGCGCTCTGCTCGTGGGTGCTCGCGATGGAAG
TCTACTCGACCGTCTTTCGGCTCGTCGCGCCCAAGCGCGAAGTGCTCAAAAAGTCGCAGCAAGCGCTCGAGTCCAAGCAAAAGGACCTCCAGCGGGCCAA
AGGCAAGCTCCAAGAGGTCACCGAGAAGGTCGAGTCGCTCAAAAAGCAGTACGACGACAGCGTCAGCGAGAAGAACGCGCTGCGGGAGGAGGCCGAAGTG
CTCGAACTCAAGCTCTCGCGCGCGACGCAGCTCGTTTCGGGTCTCTCGGGCGAGCGCGAGCGCTGGCAAGTGAGCATTGCGACCAAAGAAGGCTCGCTCC
TCAACGTCGTCGGCGATGCACTCGTCGCCGCGGCCTTCCTCTCGTACGCAGGTCCGTTCGACACTGCATTTCGCGCGTCGCTCGTGGATACGTGGTCCAA
CCGGGTCGTGCAGCAAGGGCTGCCGCTCTCGCCGTCGTTTCAGTTCACCGACTTCCTCGCCGACCCGACCGACGTCCGCCACTGGAACGCGCACGGGCTT
CCCCGCGACAACCTGTCGACCGAGAACGGCGTCGTGACGACGCGCGGGAAGCGCTGGCCGCTCATGATCGACCCGCAAGGCCAAGGCAACAAGTGGATCA
AGTCGCTCGAGGGCGCCAAACTCGACGTGGTCGACCCGATGATGAAGGACTTTCTCCGCAAGCTCGAGAACGCGATTCGGTTTGGCACGGCCGTGCTCAT
GCAGGACGTCCAGGAAGAGCTCGACCCGAGTCTCGAGCCGGTTTTGACCAAGAGCATCGTCAAGGTCGGCAACCGCGACATCCTCCGCATCGGCGACAAG
GAGCTCGACTACAACCACGACTTTCGGTTTTACCTCACGACGAAGCTGCACAACCCCCACTATACCCCTGAAGTCTCGACCAAGACGACGATCGTGAATT
TCGTCGTCAAGGAGCAAGGCCTCGAGGCCCAGCTCCTCGGCACGGTGGTGCAGATGGAAGAGCCCGCGCTCGAAGAGCAGAAATCCGAACTCGTCATCAA
GGTCGCGGCCGCCAAGCGCAAGCTTGTCGACTTGGAGAATGAGATTTTGCGCCTCCTCTCGGCCGCAAAGGGCTCGCTCCTTGACGACGAGTCGCTCGTC
AACACGCTCAATGCGTCCAAGACGACGTCGGAAGAAGTGAGCTCGCAGCTCGTCGTGAGCGAAGAGACCGAGCGCAAGATCGACGCGGCGCGCATGGGCT
ACGTCGCCGTCGCTGTCCGCTCGTCGACGCTCTACTTTGTGCTCAACGACATGACCAAGGTGGACCCGATGTACCAGTTCTCGCTCGACTCGTACGTTGA
CTTGTTCAAAGAGTCGATCGCGAAGAGCCGGTCGGCGCGCCAGACGCTCACGCTGACCGACGACCTCAGCGAGCGCATCAGTGCCATCAACGAGTACCAC
ACGTACGCCGTTTACGCCTACGCCTGCCGCGGTCTCTTTGAGCGGCATAAACTGCTCTTCTCGTTCCAAATGTGCATTCGTGTGCTCCAGAGCCTCAAGA
AGGTGCCGCAAGACGAGTACGAGTTCCTCCTCAAAGGCGGGAGCGTGCTCGGCCACGACGAGCGCGTCGCCAACCCGGTCGCGGATTTCTGTCCCGAGAG
CACGTGGAATGCCGTCGTGGACCTCAACCGCCTGCCCCGTTTCCAAGGCCTCGTGTCCTCCTTTGAGCAAACGGGCAAGGGGTGGAAGCAGTGGTTCCAG
AGCAGCGCGCCCGAGATCGAGCAGCTGCCGGGCGACTGGGAAGGCAAGTGCAACGAGCTCCAGCGCATGCTGCTTCTCCGCGTGCTCCGGTCGGACCGCG
TGACGATCCAAGCCTCGAAGTTCGTGGCCACGAACCTCGGCGCGCAGTTTGTGGACCCGCCGCCCTTCGACCTCCGCGCCATATACGACAACTCGACATA
CAAGACGCCGCTCATTTTTGTGCTTTCGCCCGGCGTCGACCCGACCAACAACCTCATGGCGCTGGCCGAGTCGCTCAATAAGAAGGTCGAGAACTGCGCC
CTCGGGCAGGGCCAGAGCGGCTTTGCCGAGGCGATGCTCGCGCGCGGGCTCGAGGGCGGCCACTGGGTCTTCTTGGCCAACTGCCATCTCATGCTGAGCT
GGGCGCCGACGCTCGAGAAGCTCATCGACAACTACTGCGCCAACCCGAGTGTGAACCCCAACTTCCGGCTCTGGCTCACGAGCGACCCGAATCCCAAGTT
TCCCATCGCGATCCTCCAGCGCGGGATCAAGATGACGACCGAGCCGCCGCGGGGCATCCGTGCCAACTTGCTAAGGCTCTACAACACGATGACCCCGGAG
CGGTTCGGGCGCTGCAAGCAGACGAAGAAGTACAAGCGGCTCCTCTTCTGTCTCTGCTGGTTCCACGCGCTCCTCCTCGAGCGGCGCAAGTTCAACAACC
TCGGCTGGAACATCCCGTATGACTTCAACGAGAGCGACTTTGCTATTAGCGAAGACGTGCTCGCGATCTATTTAGATGAGTACGACGAGACGCCATGGGA
GGCGCTCAAGTACCTCATCGCGCAGGCCAACTATGGCGGGCGCGTCACCGACGACTGGGACCGCCGCTTGATGCTCGTCTATGTGGGTCAGTTTTTCTGC
GAGGACATTTTGGAGCTCGAGATGGCGCCGCTCTCCGAGTCGCCCGAGTACTACGTGCCGGACGACGGCGACCTCGCAACGTACGGCGACTACATCCGCA
ACCTCCCGCTCGAGGACCCGCCCCTCGCCTTTGGCCAGCACCCGAACGCGCAGATTGCATCCCAGATCGACAATGGCCGGGAGCTCCTTAGTACGATCCT
GAGCTTGCAGGCCATGGGCGGCGGCGACGGCGGCAAAGGCACCGACGAAAAGATCCTCAGCGTCCTCCAGAACCTCAAGGAGAAGGTGCCCGACCCGTTC
GACCTCGCGACGGTCAAGCTCAACCTCTCGGCGCGCAGCGACCCGGACGCGCTCAAGACCGTGCTCGTGCAGGAGCTCGAGCGCTACAACAAGCTTCTGA
GCACGATCAAGTCGTCGCTAATTGCGCTGGAGAAGGGACTCCAAGGCCTCGTCGTCATCACGCCCGAACTCGAAGGCGTCTCGCAGGCGCTCTTGTTGGG
CGCGGTCCCCAAGGCCTGGAGCTTCTGCTACCCGTCACTCAAGCCGCTTGGCGCGTGGACGACCGAGCTCGAGCAGCGCGTGGCCCAGATGCGGCATTGG
GCCAACACGGCGATGCCCGTCGTCTTTTGGCTCGCGGGCTTTACGTACCCGACGGGCTTTCTCACGGCGCTGCTGCAGACCGCGGCGCGCAAGAACGGGG
TCTCGATCGACTCGCTCAACTGGGAGTTCCTCATCGTCAACCAGCACGAAGACTCGATCGCATCGAGTCCCAAGGACGGCGCGTACGTCAAAGGGCTCTT
CCTCGAGGGCGCGCGCTGGGACTTTGAGCACGACTGCTTGACCGAGCCGAACCCGATGGAGCTCTACTGCGTCATGCCCATGATCCATTTTCGACCGGTC
GAAAACAAAAAGAAGGCGGCCAAGGGCACGTACAGCTGCCCGCTCTACATGTACCCGATCCGCACCGGTACGCGCGAGCGGCCGTCCTTCATGATCGCCG
TCGACCTCAAGTGCGGCGCCCAGCGGTCGCCCGACGTGTGGACCAAGCGAGGCACGGCGCTCCTCCTCTCGCTGAGTACGTAG