Transcript Name :
Phyag_g7397
Orientation:
(-)
Number of Exons:
6
Description :
myosin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain3.6PR00193
Myosin head, motor domain3.6PR00193
Myosin head, motor domain3.6PR00193
Myosin head, motor domain3.6PR00193
Myosin head, motor domain3.6PR00193
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.035PS50096
IQ motif, EF-hand binding site6.888PS50096
IQ motif, EF-hand binding site8.425PS50096
WW domain14.186PS50020
HmmSmart predictionP-Valprediction_id
Myosin head, motor domain7.4SM00242
IQ motif, EF-hand binding site7.3SM00015
IQ motif, EF-hand binding site0.014SM00015
IQ motif, EF-hand binding site130SM00015
WW domain5.2SM00456
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1218
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
*** None ***
Sequence
        4211 bases(100 bases per row)
ATGGCCGCGAAGGAGGCGGGCGCCGGCACCAAGTGCTACGTGCCCGACGAGACGTTCGTGTGGCTGCCAGCGCAGATCCTGCGCGAGGACAAGAGCTCCG
ACCCCAAGAGGCCCGAGAAGACGGTCACACTGCGTGTATCCCCCCCACCTGGCGACGTGAACGCCGTGATAGTCGATGAGGAGCGTGTGCTGGACTTCAA
TGACCCCAAGgtcaaggcgctgctcaagagtctgcagctcgagtcGCTTCCGTATCAGAACGACAACTTGGGCCCCGACGGGATCGAAGACATGACGGCT
CTCAATTATCTGCACGAGGCTGCCATCCTCTACAACGTCAAGAAGCGCTTCCTGCAAAAGTTGCCGTATACTTACACAGGAGACATTTGTATCGCTGTGA
ACCCGTATCAGTGGCTGCCGGAGCTCTATTCGGAGCAGACGCAGTCTCACTATCTTACGAAGGCTCGGGACGAACTGCCGCCTCATGTGTACGCGACGTC
TATGGCGTCGTATAACGACATGAAGCGTCATGAAGTGAACCAGTCCATTCTTGTTAGTGGAGAATCAGGTGCTGGTAAGACGGAGACCACCAAGATTCTC
ATGAATCATTTGGCCTCTATTGCTGGAGGGCTCAACGACTAcaccatcaagaagatcatTGAGGTGAAtccgctgctcgagtcgttCGGTAACGCCAAGA
CGGTGAGGAACGACAACAGTAGTCGATTCGGCAAGTTCACTCAGCTGCAATTCGACCACGCTGGGATTCTGGTGGGAGCGAGGTGCAGAACGTACTTGCT
GGAAAAGACCCGAGTGATTTCTCatgaagagatggagagaAACTACCACATTTTCTACCAGTTGCTGGCAGCGAGTGAGAGCAAAGAGCGGTGGTTCCTC
GACGATGCCAACGAGTGCTATGCTTACACGGGTGCGAACAAGACGATCAAAATTGAAGGCATGTCGGATGACAAGCACTTCGAGCGGACCAAAACTGCAC
TGGGGCTTATTGGCGTCacggaggagcagcaagAGGTTCTCTTTGGAGTGCTGGCAGGTGTGTTACATCTTGGACAAGTGGAAATCCAGGCGAAGAATAA
TAATGAAGAATCAGAAATTGTGCCGGACAATCAGGGCGCGAAGAACGCAACCGCACTCCTAGGTATTTCGGCAGCAGATCTGGAGAAGGCCTTGTGCTCG
CGACAgattgctgtcgctggagatAAGGTGACTGCCTTTTTGAAGAAAGATCAAGCGGAAGAGTGTCTTGGTGCATTGTCTAAGGCTATTTACTCTAACG
TGTTCGACTGGCTGGTTGAAACGATCAATACTTCCTTGGAGAACGATAGGAAAATGCGCCACCATGTGGGTATTCTCGATATCTTTGGCTTTGAGCACTT
TAAGCACAACTCATTCGAGCAGTTCTGCATCAACTACGCCAACGAAAAGCTACAGCAAAAATTCACCCAGGACGTTTTCAAGACTGTGCAGCTCGAATAT
GAAGCGGAAGGTATCATCTGGAGCCACATTGATTTTGCCGATAATCAAGATGTGATTTCTGTGATCGAAGATCGACTTGGTATTATTTCACTACTAAACG
ACGAAGTGATGCGCCCCAAGGGCAATGATGAGTCACTTGTATCCAAGCTCTCAACTATTCACAAAGATGAACAGGACGTCATTGAGTTCCCTCGCACATC
ACGTACGCAATTCACTATCAAGCATTACGCAGGAGCAGTTACGTACGAATCACTGGGCTTCCTCGAAAAGCACAAAGATGCACTACTACCTGATCTGTCC
GACTTAATGCGCGGGTCCTCAAAGCAATTCCTTAGAACGATATTTACCGAAAAGGTTGGCAGTCCTGTTGCGTCACGGAAGaaaagcaacagcaacgctC
GAGCTCAAGGTGGTCGAGGTAGAGGTGCTCTGGCGGTGGCAAACGTTGGCACCCAATTCAAGGACAACCTCAACGAATTGATGACCAGCATCCGCCAAAC
GAAGGTTCACTATGTCCGTTGTATTAAGCCCAACCAAAAGAAGAGTCCAAGTGAAATGGATCAGCCGATGGTGATATCCCAATTACGTTGCGCTGGTGTG
ATCGAGGCAATCCGCATCTCGCGTGTTGCGTATCCAAACCGACTGCTCCTAGAAGAGCTAGTGGATAAATTTTGGGTTTTCGATGTGCAGCACCGCAACA
CTGATGTCCCTATCAAGCAGCGGTGCGGAGACCTGATGAAAAAGATGGAACTCTCATCGCCTGAGCAATACCAGATTGGACTTTCGCGCATATACTTTCG
GTATGGAATCCTTGAACAAATGGAGGACAAAAAGGCGGAGCGGTTGGATCTGCAAGCTCGGCACTTGCAACATTATATGCGTGGGTTTTGCTGCAGACTC
CGCTACCTTCGCAAGTTGCAAGCAATTGTCAAGCTACAGGtatgtttttttttctcgcCTCGGTTAAAATCGTATATTGCTAATGCTCTAACTGTTTGTC
TGGCGCACACGTTCTTGCATGCTAGTCTGTTGCTCGATGTGTTATCATGATGAATAGGTACCAATCATTCAAGACCGCTGTGATTGCCATCCAAGCGCAT
TGGCGTGGATACAAGGGACGATGTATCGCGCttgaggccaagaagaacaagagcgCCATCATTATTCAGAAATATGCTCGTCGCTTTGTCAAACGGTGAG
TTTACCTATGGTAAGGGCATTTTCTCACACGAAGCTAATTCGTCGTGTAAAATGTCTCCGTTGTACAGCAAACAATTCCAGGGCGAACGAAAGGGAGCTA
TCAAGATTCAAGCATTCCTACGCATGAAATACGAACGGCCGAAGTATATGAAGGCACttcaggagaagaagcagcaagctgATATGGAGTACCAGTtgag
caagctgcaggagcgcCTTCATGACGAACAGCGACGAAATGCCGAACTGAAGAAGGATCGATTGTCTACGTCGTCAACCGACAGTCAGCTGTACGCAGAA
ACCAATGGGACGCGCTCTCGGGGACGATCAACTGCTCATATGTGGATGGCAGATGCCGATGGCATCATTAGCCAGCTTAACGACGAGGCAGGTCGTTTGC
gcaaggagaacgaagagcagcgcgcgctgaCAGCGCAGCTCAAAAGTGAGGTCGAGAAGCTCAAATTTGACCAAACGGTGCAAACCGCGAATTTCCAAGT
CAAGATCCGCGGCTTCCAAGACAGGGTAGGGTCCCCAGGATATTCACGTACCCGCGTTTATCTGCATTCACTAACTGTCTATCCCTTGCACGCTGTTGTA
GCTTCGAGAAAAGGATaagaagctcgaggctgtGGAACGTGAGTGCGTGAAGctgcgtgaacttgttgGCTCTGATCCGACACACTCAAACCAGAAATCT
ATGAGGAAGGACCGTCGTTCCGTGTTCCGACGGCTAGGATCCAAAAAGGATTTTGGTGACGGCTACGACAATGGCGATGCTAGCCGAGCCTCGACCGCCA
TGCAAGCTGCACTCGCTCAGAGATCGGCCGATACAGCACTGTTCCTCCGCCAGTCCGCACGACGTATGACGCTGTGGCGTAACAACAGTGGCGGTGACAG
CGATGGTGATAATCGTTTCTCTGGCAGTGACATGGGCGACTCAGGCGGCCGCCCTTCGCTTCTGCAAGAGGTCAGTGCGGCCGGGGCCGGCGCTATGGAG
TCTTTAAAGAGCAGGCTTACCGCTGTTAAAGACAAGTACTATGGTGAAGAGAGGCCATCTGCAACTTCGCGTCAGAATGCGGAGCTTCGaagagcttctg
ctgctagGGAGTCATTAAACTTGGATGCCCTGCCACTTCCTCCTGGTTGGGAGACGCGCTTGTCGCGCTCGAAGGGCAAAGCATACTACTGCAATCCGAC
TTTGCGAATTACGCAGTGGGACCATCCATCGATGGAGACCGGCAAAGCAAAGAAGCAGGCGGCTGCACCTGCACAGCGCGCAAAGAGGTAGAAAAGAGTG
TTTAGTGGATGCTATTAACTGGGGGATTGGATGATTCTAACGGTGCGTATGTGTATAGGGAGACGACATCTACTGTGGGGAGCCCGCCACGAGAGTCAAT
TGGTAAGCTGGGGTTCATCGTATTGTTAAGCGTTTATTGTCGGTTAACTTACTCATGCTCAATTCACTTTGTACGGTAGATGGTGTGCTCACCATGGAAG
GTCAAATCTAG