Transcript Name :
Sappa_CBS223.65SPRG_00055
Orientation:
(-)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-458
NN-scoreoddsWeighted Score
0.5931.3750.003
*** None ***
TypeScore
cytoplasmic348
GO
*** None ***
*** None ***
*** None ***
Sequence
        1398 bases(100 bases per row)
CCGGACCAAGAGAAGACGAGGATGACCAAGCAAGACGCCAAGACGACCTCCTCGGCCGACGACGTGACGTTTGGCGACGTCGAGCACCAGCTGCCAGCGG
CCGCCTCTGCGATCGACGAGCTCGTGGCTGCCGCCGCCCCGGCGCCCGCGGACCAGGCCGCGATCGACGACCTTCAAGGCGCCGACGCAGCGGCTGGGCA
AGACCACGAGACGGCAGTCGCAAAGGATCGCGCGACGGCAGCTGCGCTCATGGATCGCGTTCACGAAGTGCAACATGTCGTCCCGACGGGTGTCTCGGTC
AACGCCGAGGATGACTCGAAAATGAAGGAGCCCGCCTTAAAGGTGCCCCGCGTCGACGCTGTCCGCCCGCCCAAGCTCGACCTGCCCGAGGTTGTTACCC
AGCACATCCTCACGATCATCGCCCATGAAGATACCCTTGAGTTCGTCAATGCATGGCCGACCGCGCTCCTCCCGCCGGCGTTCCTGAGTCTCAAGGCGCT
TGGCGGGGTCGTCAACTTGGACGACCACTGGCCGTGCATCGAACTGTTCACGATACCGGACGAGCACAAGCGTCTCGCTCTGACGGCGCTTCCAGCCTTT
CCCTCTGTCAAGTTTGACGTCGATTTGGCGTGGCGGACGGCCGAGCGGCTTGCAGTGACGCTGCGCGAGCTCATCGACGCGCTACGGCTGGTGCCGCAGC
TCGAGCTGACGTGGATCGAAGGCGACGACGCAGCGTCCCACGCCACGCTTTCGGACGTCGTCAACGCGTGGAGCGACAAGGTCACGGCTGTCATGTTTGT
CTCTTCCCTTCCGCTGACATACCCGACGGTCCGCGAGGCCCTCGCGCGCTGCGTTAACCTCCAGCGCGCCTATTTTCAGGGCACGTATCGAGGTGAGAGC
GCGACGCTGGAGCAGTGCGTCGAAGCTGTGACGACGCCAGCGCACCTCCACCTCCACTCGCTCTCAGTGTTCAGTGAACAAGAGTACGACGCCAATGGAA
TGGTCGCGTGGCTGGAGACGCCGCGCGCCAAGGCGCTTACGCTCTCCTGCTTGAATGTGCGCTGCAATGGCTGCTTGGCCAAAGCCATCGCCACGTCGAC
TGGGCTCACGTCGCTCTCCATCGACATACATAACGACGCCTGGTTGCTGCTGGATGCGCTGGGCGAATACGACTTGCACCGGCTGACGGATGTCGACCTA
TACATGTCGCTATGCGCGTTCGATGACCTTATCCGGGTCCTACGTCGGCTTGATGCCGACAGAGTCACGTCGCTCTACGTGAGCGGCTTGCCCAAGCCCA
CGCCCAAAGAATTTAAAGTCGTTCTTGCTCGCTTCACAGCTCTCAAGGTTTTCCGGTACGACCAAGTGAGCTACGACCAAGAGAGCGACAACGAGTAG