Transcript Name :
Sappa_CBS223.65SPRG_00043
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6880.77921
InsideOutsideTMhelix
220-254
307-326
381-391
436-682
1-196
278-286
347-360
410-412
197-219
255-277
287-306
327-346
361-380
392-409
413-435
NN-scoreoddsWeighted Score
0.5641.4150.003
*** None ***
TypeScore
endoplasmic reticulum667
GO
*** None ***
*** None ***
Cluster Id
793
Sequence
        2109 bases(100 bases per row)
ATGGTCACCACCAACAAGCTCCTGCTAGGCGTCGCAAGTCTTATCTCGACGGCGCTCGCGGCCTGCGACTCGGCCGCGTTTCCCAATGCCCCCTCGGTCG
CCCTCGGTCCGGACATGACGCTGCGCAGCCTCGTCCAAGGCGCCAACGTGTGCTTTCAAGTCACGGCGGCCGTCGCCAACGCGCGATGGGTCTCGATTGG
CCTCGCAACCTCCTCTCGGATGGTGAGCAGCCCCATCTCGAACGCGGTCGTCATGGAGATCGGGTCCGGTGCACCCACGGTGCGGCTCTACGAACTGCGC
GGGTACACGGCTGCGTCGGCCGTGCTGCAAGCCGACCAGTCGTCCATCTCGGTCGTGCGCTCGGCCGTCACCAACGGTATCGCCTCGTTTACGTTTCAGC
GACCGCTGGTGTCGCCGTCGCCACTCGACGTTGGCCTCGCAGACAACAGCGCAGCCAACGTCATCTGGGCCCACGGCGCCTCGGCGTTTCCGTCGTACCA
CGATGCCGCTGGCGCCACGCGCGTCGTGCTCTCGTCGTCGACGGGCCCGGCCCAGGTGCTCGCAGCCATCTCGACCGTCGTCAGCTCGTACACGGCCCAG
ATCGTCGCGGCGGGCTTCGCCACCATGGTCCTCCTCGGCCTCGTCGCCACGCACGCTGGCGAGTGGCGTGTCGTCAACCAAAAGACGCTCTGTGCACCGC
CGACGTCGCGCCATCTCCTTGCGGGCTTTCAGCAGTCGCTCGCCGATCTCAAGCTCGGCGAACTCGTCGTTCTTGTCGTGTACGTTGCGACGCTGATCGC
AGTGGGGCTCTCGGTCCGCGCCCAGTTTGCGGACGCGACGCTCGGCCGCGCGCTCTCGCTCATCACGGGCCACTTGGCCCTTGTCGACATGATGCTCTTG
CTCTTGCCCGTGGCGCGCGGCAAGCACTGGGAGCTCGTCTTTGGCATCTCGCACGAGCGCATCCTCAAGTTCCACCGCGGCCTCGGGCGCTCGTGCATCG
TTTACGCCACGCTGCACTTGATCCTCACCGCCGGCACTAGTGGTGTCACCAGCGCGAACGCGTTCGGGACGCAGCGCGTGACGCCGCTCTACGGCTTCCT
CGCGTTCCTTGCGTTTGCGTCCATGGGTCTTGTTGCGTTCGAGCCGATTCGCCGGCGCTGGTACGAGGCCTTCCTCTACTTCCACCGCGTCGCCGCCGTC
GCCGGCATTGTCTTGGCCATGCTGCACAGCAAGGCGGTGGTCTACGGCATGATCTTCCCGCTTGTCATTTACGGCCTCAGCGCCCTCGGCCGGCTCCGCG
CCTTCTTCAACCGCTTTGAAGCCCATGTCGACGTGAGCGCCCCCGACACGGTCACGCTCCTGTTGCCGTCGACGCCGCAGACCAAGCGCTGGGCAGAGAC
CATGAACCCCTGCGCCTTCTTCTACGTCTGCGTCCCGTCCATCTCGGCCACCGAGTGGCATCCGTTCTCGGCGATCGTGTCGCCCGACCAAGATTCGATC
GGCTTTTGCATCAAGGCCCCGAAGAAAGGGTCTTTTGTCGACAAGGTCTGCCTGGCTGCGACCGATGCGACGACAATGACGGTGCTTGTTGGCGGGCCGT
ACGGCAAGCCCGCCGTCGACCTTGGTCGGTACGATCACGTGGTCATGGTCTGCGGCGGCATTGGCGTCACTCCGATGCTGAGCGTAGTGAACCAGTGCCG
CGACAAGGGGGGCGAGTCGCGCCGCGCCAACCTCGAAATGCACTGGGTCGTGCGTGCACCCACCGATCTCTTGAGCGCCGACCGACTCATGTTCCCGCTG
CCGAATGATGCCGTGTGCAAGCTCTACAGCACGGCTGCCGACAACGACAGCAGCCTCCTCAGCAGCACGGGCGAGACCGTGCACTACACCCGTGGCAAGC
CGATTCTAGACGAGGTCATCAACCTCGAGCGGTTTCTGGGCAAGAAGGTGTGTGTGCTCGCGTGCGGCCCACCAGGCCTCGTGGCCGACGTCCAGCGCCA
CGCGCGGTCGATCAACGTCGACTTCCACAAAGAAGTCTTCTTGTTCTAGCTCCTCGATCTAAAGCTGATAATTTGATACATTGCAATTTTAAAGAAACCC
AATGTCGAG