Transcript Name :
Sappa_CBS223.65SPRG_00057
Orientation:
(+)
Number of Exons:
15
Description :
acetyl-CoA carboxylase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-746
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K01965
K01965
K01965
K01965
K01965
*** None ***
Sequence
        2986 bases(100 bases per row)
GGAATTTTGGCCGTTCTGACGAGGTAGACGTGCATGGCGATCCTCGGACGATGCTAAGCGGATGCGACGATCATGGTAGATGTATCGCTTCCGCACCTCT
GCCAAGCCCGTGCTGAAGCCGCTCATGGCGCGCCTGCAGACGACGGCGACCCCCGAGAAGCTCTTTGATAAGATCTTGATCGCGAACCGTGGCGAGATCG
CTTGCCGCGTCATCAAGACTGCGCGCCGCCTGGGCATCAAGACCGTGGCCGTCTACTCGGAGCCCGATGTCAACTCGGTCGCCGTGCGCATGGCCGACGA
AGCCATTTGCGTCGGGTAGGCCACGCGACGCGCGACGTGTGGTGCTCATGCCACATTAGCCCGGCCAAATCGGCGTCGAGCTACTTGAACATTGAGCGCA
TCATGGAGGCGGTCAAGCAGACGGGCGCGCAGGCCGTGCACCCGGGCTACGGCTTCTTGTCCGAGAACAAGCTCTTCTGTGAAGCGCTCGACGAAGCCGG
CGTCACCTTCATTGGCCCTGGCTTCCACGCCATCGAAGCCATGGGCGACAAGATTGAATCCAAGCAGATCGCCATTGACGCTGGCGTGCGTGAACTATAG
TCTGCTTCCTGCACTCAAGCGCCATTAGGTCAACACGATCCCGGGCTTCCAAGGTGTCATCCAGGACGAAACCGAAGCTGTCAAGGTCGCCAACGACATT
GGCTACCCTGGTACGCGCTTCGGAACCACCGCAGTTGTCGCTCATCCATCTCCATTTCAGTCATGGTCAAGGCCAGTGCCGGTGGCGGTGGCAAGGGCAT
GCGTGTGGCGTACAACGACGCCGAAGTCCGCGAAGGCTACCGGTACACACCTACGATCTTCTAGTAGCGACTCACAAGCTGCTGTCTAGTCTCTCGAAGG
AAGAAGCCGCCAACTCGTTTGGCGACGACCGCATGTTTATCGAAAAGTTCATCGAGGACCCGCGCCACATTGAAATCCAGCTGCTCGCGGACAAGCACGG
CAACTTTGTCGCGTTCCCGGAGCGCGAGTGCTCGATCCAGCGCCGCAACCAAAAGGTACGCCTTATCTTGGCGCATTCCAGCGTATATATTATGATGTCT
CTAGGTCATTGAAGAAGCCCCGTCGATGCTGCTCGATGACGCGACGCGCCTCGCCATGGGGTAGCCTCGATCAAAATCTCATTTCCAAAACTAAGATCGT
ATGTAGCGAGCAAGCCATCATGCTCGCCAAGAAGGTCGGCTACACGTCGGCGGGCACCGTCGAGTTCCTCTGCGACAAGCACAAGAACTTTTACTTTTTG
GAAATGAACACGCGCCTCCAGGTCGACTCGTGTCGCCATGGCTATCGACAAACTCAACGTGCACTAGGTCGAGCACCCGGTGACAGAGCTCATCACCAAG
GTCGACTTGGTCGAGCAAATGCTTCGCATCGCCGCGGGCCACCGCCTTCCCGAGTGGATGACGGCCGGGCCACTCAAGATCCACGGTACACCTTGATACA
TTACTGAAAGGTTGATATTTAGCGTGAAACATTGTAGGCTGGGCGATGGAGTCGCGCATGTACGCCGAGGACCCGCTGCGTGGGTTCCTGCCGTCGATCG
GCCGCCTCCTCAAGTACAACGAGCCGCACCACTTGCCCGGCGTCCGCGTCGACTCGGGCGTCACGGAAGGCAGCGACATCAGCATGCACTACGACCCGAT
GATCTCCAAGCTCATCACGCACGGCAAGGACCGCAAGGAGTGCCTCGAGCGCATGAAGTTTGCGCTCGACCACTACGTGATCCGCGGCCCGGGCCACAAC
GCAGCGTTCCTCCAGGACGTGTACCGCCACCCGCGCTTCGAGGCCGGCACCATCACGACCAAGTTCATCGCGGAAGAGTACCCCGACGGCTTCCAAGGCG
TGCAGCTCACGCCGCCCCAGAAGCGCGAGATCATTGTCGCTGGCGCCGCCATGCACATCAAGGCGCTCCAGGGTACACTCCCTCTTTGCGGCGTGTAGAT
TTGTTGTATCCAACCGTCTTGGATAGCGTCGCAGGCGCCGCTGGCCGCGACCAAGCCCAAGGTGCTGAAGACGCTGCCCGTCAGCGCCAACTGCGAGCTC
CGTCACGTGACGTCCGCCTCCAAGGGTATTGACTATTCCCTTCTTGCGAGGCCCGTCCGCTCACATTTTGATTAGTGCCCCGCTTCCAAGTCCGTCTCTT
GACGCCGACGGCGTCCGTGCCGTCGGCCAAGGAGCTCGCGGCGCACATTCCCCAGTCGTCGGGTATGCAATTCACTGGAAAATGAGTGGGCAATTCACTC
AATACGTAGCGTTCGAGCTCTACGTGAGCGCGGACGGTCCGTTTGGCGACGCGACGCTCCTCAAGCTCGTGGAACTGGAAGTCTCGGAAGACCACTTCGT
CCTCTGCGCGTGGCTCGACGGTGCGTGCGATTGCTTTCATTCCACGGACTCATCCCTCTCTGCGTAGGCGACTTTGTCGTGCTCAGTGACATTGAGTGGC
CGATCAACGCGCCGCTCTTCACGGCCGAAATCTCGGACAAGGCGCGCGCGCTCCAGGTGCTGCAGGTGCTCCCCGAGGGCTTCCGCGTCCAGCACCACGG
CGCCATCCACGACGTGGTTGTCCGCACGCCGGCCGAGCACGCGCTCGCCTCGCACATGAAGCCCAAGCCCAAGGTCGATCTCTCGCGCTTCGTGCAGTGC
CCGATGCCCGGCCTCCTCGTGTCCGTGGCCGTCCACGCCGGCGACGAAGTGCAGTTGGGCCAGGAAGTCGCCGTCGTCGAGGCCATGAAGATGCAAAACG
TCATCCGCGCCGCCAAGAAGGGTACGACGCTCGTGCTTTTCTGCGCCGAAATGCCAATTTGCTGTGTTAGGTGTCATCAAGTCGGTGTCGCACCAAGCCG
GCGCGTCGCTCAAGGTCGACGACATCATCATGGAGTTTGAGTAGAAGCATCGAATGCGTGTTATAACAGGACGAAGCACTTAGCGT