Transcript Name :
Sappa_CBS223.65SPRG_00006
Orientation:
(-)
Number of Exons:
1
Description :
protein kinase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-333
NN-scoreoddsWeighted Score
0.6031.4570.003
*** None ***
TypeScore
mitochondrial391
GO
*** None ***
*** None ***
*** None ***
Sequence
        1110 bases(100 bases per row)
GGAGCGGGCGCGCCCGTGAGCCGACATTGTCCAACTTCGTTACTTTCACGCATATCACCATGCTCGGCCGCGCCAGCACGCTCCGCGCCGCCTTGGTCAA
GCCGACGGCGGGCCAGCGCCGGCGCCAGCACACACAGGCCGGCGTCGGCCCCACCCTCTTTGGCGGCAGCGTCTTTGGCCTCGCGCTGCTCTCGTCGCTC
GCCGAGCCCAAGCCGCTCGCGCAGGCCGAAGCCGCCATGCTTCTCAAGCCGGACCCGCTCAGCTCCAAATACCACGTCGGCGGCGTCATTGGCTCGGGCG
GCTTCGCACGCGTCTGCGCTGGCCGCGAGAAGCAGTCGGACACGCCGGTCGCGATCAAGCGGCTCTCCAAGGCGTTGACATCCAAGGCGCGCTTTGAGCA
AGAAGTGTCGATTTTGACGCAGGTCCAAGGCAGCAACGCTGTCGTGCAGCTCAAGGAGGCTTTCGAGACGCCGGAAGACTACGTGCTCGTGACCGAGTAC
ATCCAGGGCGGCGAGCTCTTTGACCGCCTCCTGAGCCACGGCACGTACTCGGAGGCGCAGGCCAAGGCGCTCACGCGGGAGATTTCGTCCGCGCTGCAGC
ATCTGCACGCGCGAAACGTCGTCCACGCCGACGTCAAGCCCGAGAACATTTTGCTCCAGTCCAAGAACGACTCGGCGCGCATGATCCTCATCGACTTTGG
TTTGTCGTTCCATGTCAACGACCGCGCATCGAACCACCGGTGGGACGGCTCTGGCACCATGGCGTATGCTGCGCCCGAGGTGCTCAAGAAGGAAACGATC
AGCAGCGCCATCGACATGTGGGCGCTCGGCGTCGTGCTCTTCGTGCTCCTCGCCGGGTACCACCCGTTCGACCCGACCAACGAGGCCTCGGACCGTGATC
TGCGCGAACGCATCATCGCGGGTCAGTACGACTTCAACCACGACGCCTGGACCAACGTATCCAGCGACGCCAAGGACCTCATCCGGCAACTGCTCCAGGT
CGACGCCGCCAACCGCCCGAGCGCAACCAGCGTCCTCACGCACCCGTGGATGCAAGCGTAGGCGCACCCCACCCCCATTTCTTATAGTTCTAATTTATAC
GTTTCCCGTG