Transcript Name :
Sappa_CBS223.65SPRG_00047
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6510.80419
InsideOutsideTMhelix
212-251
303-322
378-397
1-188
275-283
343-356
421-678
189-211
252-274
284-302
323-342
357-377
398-420
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
793
Sequence
        2112 bases(100 bases per row)
TGAGGTCTGAGTCAATCAGAGCGGGATGCGCATTCTTCCATTTTCCATTTCGCAAGCATGTGGACGACCCGCGTGCTGGGTCTTCTCAGCCTCGCGTCCC
TCGGCGCGGCCGGCGCGTGCGATTCCGCGAGCTTCAACGCGACGGCGTCGGTGGCCATCGCATCAGCGATTGCCGTGCGCAGCCTGGTTGTCGGCGCCGA
GGCGTGCTTCCAAGTCACCTGCACCGAGCCGTCGGCGCAGTGGGTCTCGATCGGTTTTGCTGCCTCGTCCAAGATGGTCAACAGTCCCGTCACCAACGCG
GTCGTCTTCAAATCGGCATCTACCTCCGTTCAACTCTACGCCCTCGGCGACTACAGTGCGTCCGGCATCACCCTCCAAGCGGACCAGTCGGCCATCCGCG
TGGCCCAAGCCGCAAGTGTCAACGGCGTGGCGACGTTTACATTCTCGCGCGCCTTGGCGGGCTCCAGCGCCGACGTGGCCTTGACCGACGGCGGCGAAAC
GACGGTGCTGTGGGCCTACGGCACGTCGGCATGGCCCGCCTACCATGCCGCGCGTGGCGCCACGCGCCTTGTCCTAAGCTCGGGCGTGGGCCCGGCCCAA
GTGTTTGCCGCGGCGTCGACGGTCGTCACCACGTACACCGTGATCATTGTCGCCGCGGCGTTCGTGACGCTGCTCGCGATGGGCCTCATCGCGACGCACG
CCGGTGACAACTGGCGCGTCATCCACCACAAGACGCTGCTGGCGCCGCCCGGTTCGTCGCATGCCGCAGGCGCCGTGCTCCAGCCACTTGCGGACGTCAA
GGTCGGCGAGTGGCTCGTCGTCGCCGTGTACATTGCGACGCTCGCCATCATAGGCGCCTCGGTCAACCATCAGTTTGTCGGTGCGAGCGCCACCCGGGCA
GCCAGCCTTACCACGGGACACTTGGCGCTCGCGCACTTGATGCTCTTGCTCTTGCCCGTCGCGCGCGGCAAGCACTGGGAACTCGCTTTCGGGATCGCGC
CGGACCGGATCCTCAAGTTTCATCGGGCGCTCGGGCGTGTCGGCGTCCTGCTCATGCTGGCGCACCTGCTTTTGAACGCCGTCGACAGGAACGTGACGAC
GGCGACGGCAGTTGGGACGCAGGAAGCCGTGCCGCTCTACGGCTTCCTCGCGTTCCTTGCGTTTGCGTCCATGGGTCTTGTTGCGTTCGAGCCGATCCGC
CGGCGCTGGTACGAAGCCTTCCTCTACTTCCACCGCGTCGCCGCCGTCGCCGGCATTGTCTTGGCCATGCTGCACAGCATGGCGGTGGTCTATGGCATGA
TCTTCCCGCTTGTCATTTACGGCCTCAGCGCCCTCGGCCGGCTCCGCGCCTTCTTCAACCGCTTTGAAGCCCATGTCGAAGCCGACGCTCACGGCACGGT
CACGCTCTTGTTGCCGTCGACGCCGCAGACCAAGCGCTGGGCAGAGACCATGAACCCCTGCTCGTTCTTCTACGTCTGCATCCCGTCCATCTCGGCCACC
GAGTGGCATCCGTTCTCAGCAATCGTGTCGCCCAAGCAAGATTCGATCGGCTTTTGCATCAAGGCCCCGAAGAAAGGGTCGTTTGGCGACAAGGTGTGCC
GCGCTGCAGCGACATCACCGGCGCTGAGCGTGCTTGTGGGTGGACCGTATGGCAAGCTCAGCGTCGATATCGCCAAGTACGATCGCGTCGTCATGGTCTG
CGGCGGCGTCGGCGTCACGCCGATGCTGAGCGTCGTCAACCAATCGCGCGACGACAAGCGACACCGCGACGGCAAGTTTGTGTTGCACTGGGTCGTGCGC
GCGCCAAGCGACCTGCTCATGGCCGACAGCCTCATGCACCCGCTGCCGCTCCACGTGACGAGCACGCTCTACGTGTCGACGGCGACAGCAGGAAGCAGCG
CCCGCAGTCTCTCGGGCGAAGACGTTGCGTTTCTTGCTGGACGGCCCGTGCTGGACGAAATCCTCAACCACGAGCGGTTCCTCGGCGAGAAGGTCTGCGT
GCTCGCGTGCGGCCCGCCGAGCCTCGTCGCCGACGTCCAGCGCCACGCCTACGAGTTGGGGTTTCCATTCCATAAAGAAGTGTTTGCATTTTAAGTATCA
AATTTATCCGGA