Transcript Name :
Sappa_CBS223.65SPRG_00032
Orientation:
(+)
Number of Exons:
9
Description :
tRNA pseudouridine synthase putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-494
NN-scoreoddsWeighted Score
0.6311.6350.003
*** None ***
TypeScore
mitochondrial435
GO
*** None ***
*** None ***
Cluster Id
4531
Sequence
        1880 bases(100 bases per row)
GCATTGCGATGGAGTCCAGCAACCCAGCTCTTCTGGCCGCGCTTCCTGCCGACGGCGTCGTCGCCCAAGCACTCTTCACGGCCCATAGCACTGGGCTGTG
CATCCGCTGCTGCATGCGCTTCGCCGGCATCTGCGACGAGAAGCTCTACCGGTAGCACCTCCATCGAGGTCCTCGCTCACGCTCTCTCTGCCAGGCGTCC
CGCCGCCGAGCTCGCAGCCACGTGGGCGGCCTATGCGGCGCAGCACGCGCAAGTCGACCACGCTGCCAGCGAAGATGCGGCCAATTGCACGGTCTGCCTC
AACATCTTTGAAGGCCTCTTGTCGCCGGAAGGCCTGGCCATGGTCGAGGCCAGCGTCCGCGACAGCGGCTACACGACGACAACGTTTCTCATTGCCATCA
AGATCCCGAGCTCTGTGCTCATCCGCCAGCATGCGCTTCTGCAGCACCTCAAGACGAAGCTCAACCCTGTCGACTTGAAGGAAGTGCTCAAGGTATCTAA
TGTACCATCTCTCCAAGCGCGTGGTATATCGTCAACGACTAGTGGTGCATCACACCCATTTTCGCGTCCTACTTGGGCGACGCGACGTACGATGCCTCGA
GCGATCTCACGGTGCACCTGCAGTTCGGCCACCCGCTCTCGGAAGCCGAGGCGATGCAACTGCCGTCCCTTCGCGTCTGCAAACTCTTCCACGTCCTGTC
CTCATGCTGTACAACGTTGTAGGACACGATCATGCAGAACAAGAAGCGCAAGCTCGAGATCGACGGCTTTGGCGCCGTCTCCCGCGCGCTCCACAACCTC
CACGTGCTGCCCGCGGGCGTGCCGAGTCCGCCCACGCGCGCGCAGTCGGCCGCGTCCATCTCGGTCTCGGTCGAGCGGGCGCCCGTTTACGTTGCGGGCC
GGTACCTCAAGTTTATGCGCGGTCTGAGCCAAACGCCTTGGTACTTGTTCTATCCATATCCATGTAACTCATATATGGATGCTAGGGTTCTCGATGGCGA
GCGTATGGGCGACTCGTCCGTGGAAGAGGCCATTGGCGACATCATTTCGCCTGTGTTTGGCGCCAAGTCGTACAAGTTCCACACGGCGGGCCGCGAAGAC
GTGGACGTGCGCATGCTCGGGAACGGTCGGCCGTTCATCCTCGAGCTGCTCGGTACCGCAGAAGGCATTTTTTCTTCGTCGACCTTATCGCGTTGCTTGG
TGGTAGATGCCAAGGTGGCGACGCTGCCTGCCGATATGTACGCAACGGTCCAGGCCCAAGTCAACGCCGCCAACACCGACATTGTCGAGATCCGCGAACT
CTCTTCGGCGACCAAGGTGCGATGCCAGATGGCGAGATAGCCTCCGGGAGCACGTGGTATGTAGGAGGGCTTTGCCGCGCTGCAGTCGGGCGCCGACTCG
AAGCGCAAGACCTACTGGTACGTCACCTGGTGTCGTGTCGTCCAGTGTATCTCATCATACGCAGCTGCGTCGTCTGGACGTCTGGCGTGCTTACGCCCGA
GCGCGTCGCGATCCTCAACGGGATTTGCGACTTGCGCGTCGGCCAGAAGACGCCGGTGCGCGTGCTCCACCGGCGCACGCTCCTGACGCGGCCCAAGGTC
ATCCACGACGCCAGCGTCGAGCTTTTGAACGACCACTACATGCTCCTCCGCCTCACAACGTCCGCGGGCACGTACGTCAAGGAGTTTGTGCACGGCGACC
TCGGCCGCACGTACCCCAACGTGGCCTCGCTTCTCGTACCCTAGCAGCGTCTTCGAGAAGATGAAAAACTCATCTCTGCGACGATAGGGCTGCGACGCCG
ACATTTTGCAACTGGACGTCGAGAACCTCATTGACGGCCAGCCCGGTGACGACGCCGACGTCGACATGGACGACGAGTAG