Transcript Name :
Sappa_CBS223.65SPRG_00019
Orientation:
(+)
Number of Exons:
1
Description :
unnamed protein product
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5980.7919
InsideOutsideTMhelix
28-78
1-4
97-116
5-27
79-96
NN-scoreoddsWeighted Score
0.5751.3270.003
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        483 bases(100 bases per row)
CAAAGGAGGGCGTAGGGAGCCCGTCGCTAACACCCGCGGACGCCCAGGGTTCGTCAGTCGTTGTCATTCGCGATACGAGCATGGTTCCCCGCGTCTTCTT
TGTCCTTCTAGTCCTCGTCGCTGCCGTCGCCGCCACAGCACCGGCGGCGGCGATTTGCCATGCGTGCGCGACGACCGGCCGCTGCGCCGATGTCAAGTAC
TGTGGTGTGTGGCCGACGACCGGCGCCTGCTGCTGCAACCTCGATGCCGTGTGCCCTGTTCCGACGCGCGACGGAACGTGCGAGTGCCGAGAAGCGGCGG
CAACGCCGTCGACGCTGCCGTGGTTCGTCTTCCTCGTGTGTTTCTTCATCGGCATGCTGCGGCTCCTCAGCGATAACCCTATCGAGGCGGGCGTAAGCCC
CGTCGCGACGGCCCTCGGGTACTCCTTTTAGCAGCACGCACACCAAGTCCTACTAACGTTACTATATGTTCTCTCTACTTCCG