Transcript Name :
Sappa_CBS223.65SPRG_00002
Orientation:
(-)
Number of Exons:
2
Description :
cwf21-domain-containing protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-198
NN-scoreoddsWeighted Score
0.541.50.003
*** None ***
TypeScore
nuclear913
GO
*** None ***
*** None ***
*** None ***
Sequence
        966 bases(100 bases per row)
ATGTACAACGGGATCGGGCTCGCGACGACCCGCGGGTCGGGCACGAATGGCTACGTGCAGCGCAACCTGAGCTACGTCAAGCCCGCGCACCAGCGCGAGA
AGGAGCGCCAGGCCATGATGGGCTACGCCAAGTACGAGGAGCCCCACAAGAAGACGGCCGTCAACAAGCAGATCCTCGCGCACGAGCGGAAGCGCCAGGT
CGAGGTCAAGGTCATGGAGCTGCGCGACCAGCTTGAAGAGCAGGGCTGCGATGACGACGAGATCGACGACAAGTGCGACGCCCTGCGCAAGCAACTCCAG
GCCAAGGCGGAGAAGGACGGCGACGGTAACGACAAGGGCGCTAGCAGCCACGCCCGCGCGGTCCAGAAAGAAAAGCAGATTGCACAGCTCAAGGACGCGT
TCGGCATTCGCAGCACGTACCGTGACGGCGCGAGCTTCGACTTTGATGCGCAAGCGGCGCAGCGGCTCGAGCGCCAAGAAGAGTTTGAGCGCAAGCAACG
GGCCAAGGAGACCACGGAGCGCCGCCGCCTCCGCGATGCTTCTTCCGGTAAGAAGGAGAAGCGCAAGCGACGCAAGCGGTCTCCATCATCCAGCTCGTCA
TCATCGAGTTCGTCGTCGTCCGACTCATCCTCCGACTCCAGCGACGACGAAGGCGCCCGGGCTCGTCGTGAGCCTGCGGGCGACCGGAAGAGCCGATCCC
GCAGCCGCCACAATGCCGCGCACACGAATGCACCCGGTAGCCGAGCTAGCCCCAAGCGTCGCACACCGAGCCCGAACAAGCGTGAGGAAAGCCCGCGTCG
TCGTAGCCCTCGTCCCCGCAGCCCGGAAGGCGAACGTCGGAGCGGCAGTCCTCGTCGCCGGAGCCCCAGTCCTCGCCGTCGGAGCCCCAGTCCTCGCCGT
CGTAGCCCGAGCCCCCGCTGTCGGAGCCCGAGCCCTCCCCGCCGGAGCGGCAGTCCTCGTCGCCGG