Transcript Name :
Sappa_CBS223.65SPRG_00046
Orientation:
(-)
Number of Exons:
1
Description :
60S ribosomal protein L40, partial
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-53
NN-scoreoddsWeighted Score
0.7971.6950.003
*** None ***
TypeScore
nuclear913
GO
*** None ***
*** None ***
*** None ***
Sequence
        162 bases(100 bases per row)
ATGGCCATCGAACCGACGCTGGCGGCCCTCGCCAAGAAGACCAACTGCGAGAAGCAGATCTGCCGCGTGTGCTACGCGCGCCTCCCGCCCCGCGCGACCA
ACTGCCGCAAGAAGAAGTGCGGCCACTCCAACCAGCTGCGCATCAAGAAGAAGATCAAGTAA