Transcript Name :
Sappa_CBS223.65SPRG_00011
Orientation:
(-)
Number of Exons:
6
Description :
ABC transporter-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-348
404-423
479-482
580-587
372-380
447-455
506-559
349-371
381-403
424-446
456-478
483-505
560-579
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
45
Sequence
        2030 bases(100 bases per row)
ATGCTGCTCGAGTCGCCCGTCGCTACGAGCTTCCGAGAAGGCCTGCTGACGCCCAAGTGGCACGAGGCGGCGCAGCCGTGCACGCTCGGCTGGAGCCACC
TCTCATATACAGTGACGAAGCAGTGCAAGTCCATCCTGGCCGACATTTCGGGGCGGTGTGCGCCGCGCGAGATGCTAGCGATCCTTGGCCCGTCGGGAAG
CGGCAAGACAACCCTTCTGGACCTGCTCGCCGACCGCATCTCGAGTGGCAAGACGACGGGTGCCATTGAAGTCAACGGCCAGCCACGCGACCACCGAAGC
TTCCGGTCGCTCGCCTCGTACGTGGCCCAAGAGGACGCGCTTCTCGGGTCCTTTACGGTGCTGGAGACCCTCCAGTTTGCCGCACGGCTGAGCCTCCCGT
CGTCGATTTCGGCGTCGGCGCGCGAGGCTCGGGTCCGCGCTGCCATCAACGACATGGGTGCGTACCTACGCCTATAAGAAACAGGTTGGTTCGATGACGG
CTAGGGCTGTCGTCCTGCGTCGACACGCGTGTCGGGGACATCTTCCGCAAAGGGCTTTCGGGCGGCCAGAAGCGGCGTCTCAGCATCGCGATCGAGCTCC
TCGTAAGCCTTGTGCCATGCACGAAGGCGCGATAAAGTGGGCGTAGAAAGAGCCGACGATTTTGCTGCTGGACGAACCGACGTCGGGCCTCGATGCAGCG
TCGACCGTCAGCGTGGTCGAGCACCTGCGTCATTTGAGCACCGACCGGGGTTGTACCGTGCTCTGCACGATCCACCAGCCGAGCTCTGACGTGTACGACC
TATTCACGTCCGTCCTCGTCCTTGCGGCCGGTCGCACCATGTATTTCGGCCCACCCCTCGGCGCGCTCAGCCACTTTGCAGCCGCGGGGTACCCTTGCCC
GCCCATGACCAACCCCGCCGAGTTTTACCTCGAGCTCGTCAACGACGACTTTGACGGGCACGCGGACGTGCTTGCGCTCGCCAGGGAGTACGACCCGCGC
CCCGTGCTGGTACGCGCTTCTTCTAGATATCATGATACCTTGATACATTCTACAACGGAACGCTAGGCCTTGCTGGAGACGGACCGAGCCAGCTTGACGG
GTATCATCGCAAGTGACGACGGCGCGTCGGCTTTTGCCCAAGGTCTCGCGCTCCTTGACCGCACGAGCATCAACAACGTGCGGGACCCTGGCGTGTACTG
GGTGCGTCTCGGCATGTACACGGCGCTGTCGCTCACGACGGGCACGCTCTTCCTCTCGACGAACGCGAAACTCAACGAGGGCAACCGCGTCGCGCTCTTG
ATTTACATCCAAGCGTTCCTCGTCTTTATGAGCATCGCCGTGTTGCCCGTGTTCATCCAGCAGCGCGCGGTCCACCACGCCATGTTTCAATATATCAAGC
TGATACATTTGTAGGTGTTTGCACGGGAGCGCGCCAACCATAATGTGGCCGTCGCGAGTGCCGTCGGCGCCAACTTTGTGGCGGCGCTGCCCGGCATCCT
CCTCATCGCGCTGGTTTCGGCCTCGATTGTCGTGCCACTCGCGGCCCTGCGCCACTTTTGGTACTTTGTACTCAACCTCTTCCTCACGCTCGTCGTCGCC
GAGTCCTTCATGCATGTCATCGCCGCCATCGTGCCGCAGTACATTGTCGGCATCGCCCTCGCGTCCGGGATCTACGGTGCGCCTTGCTACATCGATACCT
TACCAAGTTGATACTGTAGGGATGTTTATGCTCTGCGAAGGCTTCATGGTGCCGCGGCCCGATATGCCGTCGTACTGGCTCTGGGGCCACTACGCGGCGT
TCCATTCGTACTCGTTCGAGGCCTTCTTGTACAAGCAGCTTGCACCGATGAACTCGAGCGAGAGCCGCTTTCTCCTCGCGCGCTACGGGCTTCAGGACGT
CAACTGCGACCGCAACATGCTCGTGCTCGCAGCCTACGCGCTCTCTCTTCAAGGCATCTACTTCTGCATTCTGCAGCGCTTCCACACGGGTCGCCGATAA
GCAAGCATAGTACAACGTGTCTATTCAAAG