Transcript Name :
Sappa_CBS223.65SPRG_00023
Orientation:
(-)
Number of Exons:
2
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7090.84219
InsideOutsideTMhelix
1-1
102-139
25-78
2-24
79-101
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        495 bases(100 bases per row)
ATGGTCGTGTCTCGATTGCTGGTCGTCTGCGCCCTGCTCTTCGCTGTGATCGCCACACCGGCGCCGCCAACGGCGTGCCACAAGTGCGCTCAGAGCAACC
AGTGCAGCACTGCCTACCAAGGAGGCGCCGCGCAGTTCTGCGGCAATTGGCTCAGCAGTGGCGCGACGCAGCCATGCTGTTGTCCTGCTGGCGCCGACCG
CTGCAGCGCCAAGCGCGACGCGTGCGACTGCAAGCCCGAGACCAAGAAGAAGCTCTCGACTGGTGTCTACGTGGCGATCGCCGCGGGGGTCCTCGTCGTT
GTGGGCGGCGGCGTCTTCTGCCTTTTCAAGCGGCGGCGACGGCTCCAGAAGGTGTCCGAGCCCGCCAAGATGGAGAAGACCGAGCCACCGGCATATCAAC
CAGCATATGCAGACACGTACGCCCGCGCCGGCGGGCTCGTCTAAGATCTATTTCTACCGGGTATTTAAAATAGACAACTTGTCTTGGGTTACGTC