Transcript Name :
Sappa_CBS223.65SPRG_00044
Orientation:
(-)
Number of Exons:
5
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-337
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1192 bases(100 bases per row)
CAAGATCGCATGCTGGGCAAGACCTTTGAAGAGACGTACGAGCTGCTCGAGCGCGTGGGCCGCGGCAACTTTGGCGAAGTCCACCGCATCCAAGAGATCG
CGACGGGGCGCGTCTGTGCGCTCAAGCGCATCCGCATTGGCGGCGACGCGGAGAAGATGACGCTGATTCCGTCGGCGGCGTTCAACGAGATCCAAGCCAT
GCAGCACCTCGCGCACCCCAACGTACGGAGGAATGACTCGCGGAACTTCATATTTGCTGGCGTAGATTGTGCAGCTGCTCCATGCGGTACCCGAAGGTGC
CTCTGTGGGCCTCGTACTCGAGTACATGGCGACCGACCTGGCACAGGTAGATGTGTCGATTGCATGCGATGTGGCTGTAAGAAGGCGCTAGCTTATGGCA
CGGGCGACGACGCCCTTCTCGCCGCAAGAGGTCAAGTCGCTCATGTACATGCTGCTGCGCGGAGTCGAACACTGCCACCGCCACAAGATCATGCACCGGG
TCAGTGCACCGCCGACGTTCTCGACTGACGGCAGCTGAGGATATCAAGCCGGCCAACCTTCTTCTCGACAAAGACGGTGTCCTTAAGCTCAGCGACTTTG
GACTCGCCACTGTGTACACGGGACCGAGTCGAGAATACAGCCACACGGTTGCGACGCGCTGGTACCGCGCACCAGAACTGCTCTTCGGCTCGCGCTGTTA
CGACTTGTCGGTCGACATGTGGTCCGTCGGCGTTATCTTTGGCGAGCTACTGCAGCACGCGCCAATGTTTCCAGGCCTGAACGACATTGACCAGCTCTTC
CGCGTGATCCAAGTCCTGGGGTCGCCGACGTGGGCCGGTGTCGAGAGCTTGCCTGACTACCACAAGGTGTCGTTTCCGTCGTTCTCCGCCATACCACTGG
CCGTGTTGCTGCCAGAAGTCCCGGTCCTTGCACGGGATCTATTGAGCCGTCTTCTCGAGTACGAGCCCAGCAAGCGCATTTCGGCGGCAGAGGTCCGACT
TGCAACTTGGGCTACTATCCAGCATCGTTGTAGGCGCTGCACCATCCGTATTTTTTGGCGCACCCGACGCCCGAGGCATCCATTTCGCCCGACCGACTCG
TGATGGCCGGCCTCGGAAAGCGAGATACGACGAGCGACGATTTTGCGCTGCCAAACAAACCGGTTCTGGACCTCGACATTGGGTTTCTTTAA