Transcript Name :
Sappa_CBS223.65SPRG_00036
Orientation:
(+)
Number of Exons:
2
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-59
NN-scoreoddsWeighted Score
0.9226.3260.013
*** None ***
TypeScore
nuclear565
GO
*** None ***
*** None ***
*** None ***
Sequence
        204 bases(100 bases per row)
ATGAAGACGCCGTCATCGACAGACGCGTGGTCGAAGGCCCGCAAGTCCATCGCGCGCGCCAACGCCGGCGCCAAGCGCAACATTTCCCTGGCGCCGCGCC
CGCCAACGCTCGTGGGCGGCCGCCTCGTGCCGTTTCAGCGCGCCACGCAGAGTCTTCGGGCGCTCGGCCCGATCCTCGAGGAAGACTGTCTCGTCGACGT
CTAG