Transcript Name :
Sappa_CBS223.65SPRG_00016
Orientation:
(+)
Number of Exons:
7
Description :
CDP-diglyceride synthetase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4060.6332
InsideOutsideTMhelix
1-11
86-91
142-153
214-305
35-65
110-118
177-190
12-34
66-85
92-109
119-141
154-176
191-213
NN-scoreoddsWeighted Score
0.5231.1920.002
*** None ***
TypeScore
endoplasmic reticulum667
GO
*** None ***
KO ID
K00981
K00981
*** None ***
Sequence
        1189 bases(100 bases per row)
ACCATGGGCGTCGACTGGGCCCGCCGGGTAGGGACGTTCTGCGTCGCCGCGCCGCTGGCGATCTACCTCCTCTGCAGCGCGACGGGCACGGCCGCGCTCA
CGATGCTCATCCAGACGGGCTGCCTGCTCGAGTTCCGCCTGAACGTCTGCCCGCCTATCCTGCAGCACATGGCCGGGCGAAAGCCAGCGCAGGTACATCG
CTGCAGTCGTCTGGCTCTGGCTGACGCGTGACGCAGGCGCCGTGGCTGCACGCACTGACGCTCGCTGGTCTCGGCGCGCTCGTCGCTGGCGCCGCCACGG
TCGACAAGTGGACCCATGGTGGCTCACATGCATGCGTCTACTGGCCTCACATACGGTAGATGCGACGGCCGCGGGCGTGTATTTTGCGGTCTTTCTTCTG
CACCTTCTCATGGCCAAGAGCCAGCGCGAGCCGACGCTGCACGCGGGCTTGCTGAGCCTCGTCTTGGACCTTGTCGCGCTCGGCTACATTGTCCAGTGCG
TCTGTCTACGCAACGGGCTCGCACTCATGAGCTTGTAGCGGCTTTGGCCACGCGATCCTCGTGCGCGAGGCGTCGACGACGTACGGCATGGGTCTCCAGG
TACAACCATCCTGCTCCAGCGACGGTCTCAAGCGAGCGTGCTAGATCATGACGGTGGCCTGCTCGTGGATCTGCGATACGGGCGCGCTCGTCGCCGGCTC
GCTCTGTGGCAAGGCAAAGCTCCTCGCTGCCATCTCGCCGGGCAAGACGGTCGCCGGCGGCCTCGGCGGCATTGTCTTTAGCATCGCGACAGTCGTCGGC
GCCTCGCTCCTCCCGCGTACGTCCTCCTTTTCATGGAAGAGATCGCCTCACGCGCATGTAGCTGCATATGCGTGTTTGCCGCCGCTCTCGCTCGTGCATC
AAGTGGTGCTGGGCACGGCCATGGGTGTCGCCTGCATCGTCGGCGACCTCGTCGAGTCGTACTTGAAGCGCGTCGCCCAGGTCAAGGACTCGGGTACGTC
AGGCAACAAAACGCTTGGCTCACATGGTGCAGGCGTCTTCTTCCCCGGCCACGGCGGCTGCCTCGACCGCATGGACAGCCTTCTCTTCGTCGCGCCCCTG
ATGTACTACTGGACGACGGCCATGGGCATCTAGATAGATTCAAAACAGGTTGAAAGCTCTATAATACGACTCTAATTGTTGAGGAACGC