Transcript Name :
Sappa_CBS223.65SPRG_00014
Orientation:
(+)
Number of Exons:
6
Description :
radial spoke head 10 family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-617
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2154 bases(100 bases per row)
ATCTGCCGTTACGGGTCGTTTCCGAGATGGCGGCGCCGCAGTTCCCGCTGGACCCGAGCTTGGCCGCGCTGATCATTGCCCACTACGAGGGCGAGACGCA
GCAGGGCATCTTCCACGGACACGGGCGCGCGACCTTTATCAACGGCCAAGTGTACGTCGGGAGCTTCCACGGCGGGCGCATGCACGGCCACGGCGCGCTC
ACGTGGCCCGACGGCGTCTCGTACGAAGGGGACTTTGCTTTCAACGAGGTCTCGGGCCGCGGCAAGTACGTCTGGCCCGACGAGAGCTGGTACGAGGGCG
ACGTGAGCCGCGGGCGGCGCCACGGCCTCGGCTTCTTTATGAGCAGCAACCGCGTCACGTCGTACGAGGGCAGCTGGGTCCATGGGTACCAGCACGGCTA
CGGCAAGCTCGTGTACGACGAGCTCCAGGGCATCGAGTACGAAGGCGACTGGGTCACGGGCCAGCGCCACGGCAAGGGCACGATGAAGTATGCCTCTGGC
AACGTCTACGAAGGTTTGTCGCCGTTCAGTATCAAGTTGATAGATAGATACGTAGGCGACTGGGTCGACGGCAAGAAGGCGGGCAAGGGCACGATGCACT
GGTTCGACGCCGCCGAGACGTACGACGGCGACTGGCTCGACGACGTCCAGCACGGCGCCGGCGTCCACGTCTGGAAAACCAAGGAAAAACGCGGCAATCG
GTACGAAGGCGAGTTTGCCAACGGCGTTCGCGACGGCTACGGTGTCTTTTACTACGCCAACGGCGCGCGCTACGAAGGCCACTGGGAAGACAACGTCAAG
CACGGGCTCGGGCTCTTCTTCTTTGAAGACGGCACCATTTACGAAGGTCCGCATCTGAGTCAAACACACAAAAAGTATCAATGTATCGAGCAGGCGAATT
CGTCCGCGACCGCATGGTCGACATGAACGACAATAAGAATAAGAACGCCGAGACGCTGCCGACGCTCGTCCTGTACATTGACGACATCCTCCGCCACGAA
GACAAGGCGCGCGCGCTCAAGGCCACCCAGCACGCCGTACGTCTTGCGAGACAAAAATATTCAAAGATAGGGCTAGGTCCTGCGCGCCAACACCGACTTG
CGCAATGTCTACCGGCACTACGCGTCGTGCGGTGGCACAACGACGTCGCACGCACCAGCTGAAAACAACGTGCTCATGGAGATGCGGGAGCTCTGGCGCT
TTAGCGCCGAGTGCCGCCTCAACGTGAGCTTGGGCAAGCTCAACCGGTACCTCCTCGTGGTTCGGAACGCGCAAAACAAAGCCGTCAAGAAGCTGCGGAT
CCAGCGGGAGAAGAAGGTAGTCGTATGGAGAGTCGTCCTCGGATCTGAGTCGGGCGTAGCGCCGGCACATGAACGCGCGGGCCATGGACGCGATCGTGAC
GCCGCGGGAAAAGTGGACCGACATCCACGACCCAGATCGCGTCGTGCTCTTCCGCGAGTTCTGCGAGATCCTTGTGCGCATCGCGTGGGACGATGCGCTG
GAGCGGGGCGAGGTGCTGTCTGTGCGAGAAGGGAGAGGAGCCTGGATGGTGTGCGTAGGTGGACATGACGGTCGCTGACGCGTTCACGTACCTCTACGAC
TCCAAGATCCACGACCACGCGTCGACGCCGATGCTGCCGATGGAGGCGATTGAGATCTCGGTGCACAGCCTCGAGATGCAAACTGTGTTTCAAAAGTACC
AGGAGCTGCTCGAGAAGCTCTTTGCGCAGTACAGCGGTCCGGCCGCGACGCCCGAGAGCGACTTGCACATGACGACGGGCAACTTCGTGCTCATGCTCAA
GGAAAAGCGGGGCCTCGGTGCCCTCGGAGTCCCCGGTGTCCTCAAGTGTCTGCGCAAAACCAACGACGAGGACGGCGAGACCGACTTTGACCCGTTTCTT
CTCGACGCCGAGCTCATCTACCCCGAGTTCCTCGAAGCCATCGCCAAGGTGGCCATGGCGTCCGCCACGCGCAACCTCCCGATGCCGGTGCTCGTAGCCC
AGTACATTCGCGACACGTTCGAGAAGCCACCGCCCGCGATGACCCTCCGCCGGCTCACGACCATGGTGCAGTCCAAGAAGTCTCTGGCGCACATTTAACA
GCATGTACATCATCTTCACAATAAGAAATTCGATGCACGCGCATTGTGTTGAGG