Transcript Name :
Sappa_CBS223.65SPRG_00012
Orientation:
(+)
Number of Exons:
6
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-349
405-416
467-472
580-584
373-381
440-443
496-556
350-372
382-404
417-439
444-466
473-495
557-579
NN-scoreoddsWeighted Score
0.5871.5950.003
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
KO ID
K02041
Cluster Id
45
Sequence
        1996 bases(100 bases per row)
ATGTGGAAGCACGACGAGGTGCTGCTACCGTGCACACTGAGCTGGAAAGACCTTTCGTACACGGCTCGCTCCAAGAAGGCGATCCTGCACGACGTCTCGG
GGCGGTGTGGGCCCGGCGAGTTCCTAGCGATCCTCGGCCCGTCGGGAAGCGGCAAGACAACCCTTCTGGATCTGCTCGCCGACCGCATCTCGAGTGGCAA
GACGACGGGTACCATCGCCTTAAATGGCCAGCCGCGTGAACCGAGGTCCTTCCGCGCCGTCGCCTCGTACGTGGCCCAGGACGACACGCTTCTTGGATCC
TTTACGGTCCTCGAGACGCTCCAGTTTGCCGCGCGCCTGAGCTTGCCGTCGACCGTATCGCGTGCTGAGCGCGACGCTCGATTGCAGCACGTCATCGATG
CCATGGGTATTCCTCTCTTTGTGCACCCATCGCTCAAGCACCTCGTAGGCCTCCGATCGTGCGTGCACACCCTTGTGGGCGACTTGTTCCGGAAAGGGCT
CTCGGGCGGTCAAAAGCGGCGCCTCAGCATCGCGATGGAGCTCCTCGTACATACGACATGTGGATCGTCTAGCTTTGTTCAAGCAATATGAAAGTAGAAA
CAGCCGCGCGTGCTCTTGCTGGACGAACCAACGTCCGGTCTCGACTCGGCGACGACGCTCAACGTCGTTCGGTGCATCGCTGGCCTCTGCCGCGACGACC
GCTGCACCGTGATCTGCACGATCCACCAGCCAAGCGCGCGCGTCTTCCAGCTCTTTGACAACGTGCTGTTGCTCGCGCAGGGCCGCGCCATGTACCGCGG
GTCCCCGCAAGCGATCGTCGCGCACTTTGGGCCCCTCGGGTTGTTGTCTCTGCTCGTGCTTGCGAGCCGCTGACGCTTCGTAGGTACGAGTGCCCCGAAC
ACACGAGCCCGGCCGAGTACTATTTGCGCATCGTCAACACGGACTTCCATTGCCACGCCGACATTGACGCGCTCGCCGACGCGGTCGCCACCACCAATCT
CCACGTACGATTCGTCAAGTGCTCACTCTATGAGTCTGACGATGCGGTAGGACCAGCTGCTGCTCGAGGCGACGGCGAGTGCGCCGTGGAGCGTGGCGCC
GCAGCGGCCGTCGCCAGTGGCGCAGATTCTCGTGTTTCTCGATCGCAACCTCTTGAACACGCTGCGGAACCCGGGCATCTTTTGGGTCCGCCTCGTCATG
TACTCGCTCCTCTCGGCCATGGCCGGCACCATGTATCTGCACCCGACGCCCGGCCCCGCCCACGATGCCAGCCTCGTCGCGCTCCTCTTTGGCGTGCCCG
CGTTCTGCATCTTCATGAGCGTCGCCGCACTCCCCTTCTTCCTCGAGCAGCGCGCGGTGCGTTCGTTTCGGATGGCTCTGCCTCAATCCGTGGGTTCTAG
GTGTTTGCCCGCGAGCGCGCCAACTGGGGCGTCAACGTCCTGAGCTTCGTCGTCGCCAACTTTGCCGTCGCCCTTCCCGCGCTCTTTGTCATTGCGCTCT
GCAGCACGACGCTGGTCGTTCCCGCCGCGGGCCTCGGCGGCTTTGGCGTGTACTTTGGCGCGTTTTACCTCGGCCTCGTCGTCGCCGAGTCGGTCGTCCA
CGTGCTCGGCGCCGCGGTGGGCCACGCGATCGGCGGCATCGCGCTCGGTGCTGGCCTCTTTGGGCAGTTTATGCTGTGCCAGGGCTACCTCCTCGCGCGC
GAGAGCATCCCAACGTACTGGCGCTGGTGCCACGCGCTCGCCTTTCACTCGTACGTCTTCCAAGTGCTCATGCACAACGAGTTTGCCGACCGCAGCCCGA
GCATCCTCGCCGAGTTCAACCTCGAGGACGTTAACATCGGGCGCAGCATGGGCGTCCTCGCCGCCTATGCTCTCGTGCTCCAGGTCGCCTTTGGGCTCGT
CCTCTACTTTGTGCACACGGGCCGGCGCTAAGAACCGCGTAACCCTATTTTCCACAATTCATTGCCGACACGATTACACTATATACTATTGGGTCC