Transcript Name :
Sappa_CBS223.65SPRG_00037
Orientation:
(-)
Number of Exons:
2
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4680.72123
InsideOutsideTMhelix
1-6
51-82
27-30
7-26
31-50
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        426 bases(100 bases per row)
GAAACTGAAAACGAAAATCAATGCTGCGGGGGATTGGGATCGCCCTGCGCGTTGTGCTGGTCTTGGCGCTCCTGAGCTGCATTGCGTAAGCAGGTCCTTG
GCTACGACGTGGTCTCTCACGCGCTGGAGGCGTAGGCGGCCCGTCTTCTTCTCGACTGCGAGCGTCATCGAGCCCATCTTTGTGTTTCCGCTCTTGCTCG
TGACGCTCGTCTTCAGCTGCCGCGAGTGCGTGCCCGTCGCGTGCCAAGTCGTCCAAGACGCCTGCAAACCTCCTTCGCATCATCACTTCCGCGACCAACC
CGCACTCTACTACGCATGACTTGTCCTCCTTGAACGACATCATTATGGGCTTGCAAGCGTTCCGTAGCCCTTCGCAGCTCGTTCAGAGACATAAGCAGAG
TACATGTAGATGATGTAGGATCGCCC