Transcript Name :
Sappa_CBS223.65SPRG_00008
Orientation:
(-)
Number of Exons:
2
Description :
major facilitator transporter
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-4
81-88
135-145
196-308
359-370
421-464
25-57
108-111
169-172
332-335
394-397
5-24
58-80
89-107
112-134
146-168
173-195
309-331
336-358
371-393
398-420
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1470 bases(100 bases per row)
ATGCGCCCATCAAGCGTCTTGTACGCGACGGTCGGCATCGCGCTCCTCGGGGCGTTCCAGTTTGGCTGGCTCCTCTCGCAGCTCAACTACGTTCCGTTCC
ACGCCAACTGCGACGCGCGCCCGATCCCAGTTGGCGACTGCCTCCTCTTTGCGCCGCACTCGGAGAGCAAGTGGACGCTCGCCGTCTCGGCGTGGATCGC
CGGCGGCGCCGTCGGGGCCATTTGCAGCGGCCTGCCCGCCGACATCTTTGGCCGCAAGAAGACTCTGGGCGTGAACGCGCTCATCATTGTCTTTGGCGGT
CTCGTCCAGAGCCTTGCGACAACCCTCGAGACGTTCACCATCGGGCGGCTCATCTCGGGCGTTGCGTCCGGCGTCGCCATCAATGTCTGCGAAGCGCTCA
TCTCGGAGATCTCGCCGTCGCAGATGCGCGGCACGTTCCTCACGGGCCTCCAGGTCGGCGTCGCGTTCGGCTCGCTCGCCGTCACCTCGGCGCACTACGC
CCTCGACGACAGCGATCTTCGGTGGCGGCTGCTCATGGGAGTACCCGTAGTACTTGGCGGCCTCCAGCTCCTCTCGCTTCGCTTTATGGCGCAGAGCCCC
GTGTGGCTCGTGGCGCACAGCCGCCTCGACGACGCCCGAGCCGAAATAACGCGCCTGTACCGGGCAATGGACGTCGACACGGTTTTGCATGCACTGGCAG
CCGCGCACGCCGACGAAGCCGCCGAGCTCGACGGGCGCAGCCCCGAGCACTCCTCTTCTCGCCACCGTTCCGCAAGCAGCTGGTCATTGCGATCGTGCTC
TGCGCCGCGCAGCAGCCTGGTGCGGCATGCCGGCGATCATGTACTACTCGTCCAGTATCTATGCGGGCGCAGGCATCGCCGACCCGCGCGTCGGCACCAG
CGTCGTCAACGTCGTGCGCACAAGCACCATTCTCGTCGCGGCCGCCGTCATGGACAAGTACCCGCGGCGCACGCTCCTCCTGCGCGGCCTGTCGCTGCAG
GCCCTCGCGGCCCTCGGCCTCGTCGCGAGCCTCGTGGGCGGAAGCGCCGCCGGTGCGATTCTGGCCACCGGCGTCTTTGTCGTCGGCTTCTGCCTCTCGA
TCGGCCCCATGGCGTGGACCGTCTCGTCCGAGATTTTTCCCGACTACATGCAGGCAACCGCGGGCTCGGTGGGCACCACGTCGACGTGGCTCGGCGACCT
GCTCGTCGGCCTACTGTACCCCACGCTAGCTCAAGGCAATGTGCTCGGCGGCTACGCCTTTGGCACTTTCGCGGGGCTCTTGATTGGCTTTGTGCTCTTT
GTCTATCTGTACGTCCCGGAAACCAACGGTCGCACGGCCGTCGAGATTCAAGCGGCGTTTGGCCACGATGCGCCGCCGCCACTGTCGGGCCAGAACCACA
GCGGCGACCCATGGGGCACGGAACTTCGCGCGCTCGCCACATAACAACACCATGATACCATATATTGTAC