Transcript Name :
Sappa_CBS223.65SPRG_00041
Orientation:
(-)
Number of Exons:
2
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5640.72120
InsideOutsideTMhelix
522-541
599-626
672-683
739-847
1-498
565-578
650-653
707-715
499-521
542-564
579-598
627-649
654-671
684-706
716-738
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2573 bases(100 bases per row)
ATGCAGCTGGTCCGCGTCCTCGCCGGCCTCGGGCTGCTCGCTTCGGCCGCCGACAGCGCGACGACCTGCCGCTTCGCGCTCAACGTGTCGCCGGCCGGCC
TCAAGCTGCTCGGCGGCGACCGCAACGGCACCACGCCGGCCAACAGCACGCTCGTGCTCCCGAGCGTCTCGGTCGCGCCAGGCCAGAAGGATACGACGCC
GACGCCGGTGCCGACGCAAAAAGACAACAAGAGCAAGGCGCCCGAGACGACGGCGCCGGGCCTTCGCAAGCTGCAGATTAAGCCGGTGGAAGCCGACGCG
ACGACGACGACGGCACCGACAGTGCCCACAACCATTGCGATGACCAGTGCACCGACGCCGATTCCGACCGACAAGAAGACTACGGAGCCGACGGTCGCGC
CCACCGATCCACTGACCAAGTCGCCGACGCCCACGACGGTCAAGCCGTCGTCGGGCAGTGGGAGCGGCAAGACGCCGACAACGACAACGTCGTTGCCACC
GGGCGTGACCGCGACGCCGACACCGACACCGACGCCGTCCAACTCGACCAACGTCATCAACGTCCCGGCGCCAACCGTCGCCACCACCTTTGACATCATT
CCTTGCGACGCGACGTTTTACAAGTTCTGGAAGACCAAAGGTCTCAGCTGCGGCGGCGTCGACCTCGACGTGACCAAGGCCATGGAGCAGGCGTGCAGCG
TCTACTCGGGCGCCATCACGATCGGCGCCGCCGGCTTCCCCGCGTGCTTTTCGTCGTGCTTCATTCCTGGTTGCGAGAGTAACAAGTGGGACTACGAGGC
CATGGACGGTCTCTCGTCCTCGATCTACGCCGGCGTCAACTTTCTCGAGGCCGCGTCGCTCGCCAAGGCGTCGACGTCGGCGACGGCGTCGCTCTTCCCG
ACGCTCGCGACCAAATTCAAAACGTCATTTTCGTGTACGACCTACGACGTGTGCCAGTGCCCGGCGGCCAACCTCGGTGGCGCAGGCAACAATAGCACGA
GCTCGACCACCGGCAGCCAAAAGCGCTTCGACACGTGGAGCGACGGCACGAAGAAGACGACATTAGACTACGTCGGCACGGTCACGTCCAGCGTGAGCGC
CACCGTCACCTACACGGCGATCGCGACGACAACCACGATGATGATTGCGAGCTCGGTCGGCGCCGTGGGGTCGTCCGCCTCGGCGGCCGCGGCCGGCATC
TCGACTGGCGGCTCGGTCGGCATGGCCAGCGCCACGATGGACATTGCGCAGTTTGCCGTGTGCATGAGCCAGCTCAGCTTGCCGGGCGCGTCCAAGCCGC
TCCGCGCGGTCGGCGAGCAAATGAGCTTCAGCGTCTTCAACTGGTTTACGTTTGGGAACGTGCCGACGACGACGGCCGCGATGGCCGCCAACCGCCGCCT
CGTGGAAGCGTACACGGGCCAGCGCTCGGACGAGACGGGCGGCATGTTCCAGTACACCACCCGCCTCGGCATCCGCCCCGAGATGCTCTTCTACGTGACG
CTGGCCGGCATTGCGTCCGTGATTGGCGGCATCGTCATCCTCCTCGCGCTCGTCCTCGTGCTTGGCCCGCTCTGCGTCAAGGACAAGCAAGCGTTCATGT
CCAACTGCTACGACCGCGCGATCGGCTTGATCATGCTCGTGACCATCATCTCCCAGTACGCGCTCGGCGTCGTATGCATGTTCCAGCTCTGCCTCTGCCT
CAAGTCCAAGACGAGCGTCTTCTCGAAAGAGCTCGTGTTTGCGATCTTGACGCTGCTGGTGCTCGCCGTCGGCATCATGGGCTACGGCGTGTATGTTGTC
AAGAAGTACCAAAACGCATCCAGGACATTGGCACAGCGCAGCACCTCGAGAAGACGGTCCACAAGCGCTTCGGCTGCCTCTACGACGAGTACGACTTTGC
CAACCGGTTCTTCTTCACGGCCAAGATGGGCCTTGCGCTCCTCTCGGGCATGATCGCCGGCACGTTCGCGGTCTCGGGCCAGGCGCAGTTAGTGATGCTC
ATCGTGCTCCACGTGGGTTTCTTTCTGTTGCTGAGCGTGCGCCGGCCACACTTTGCGCCGTTCGTTCAAAACACAACCGTGATCATCACAGTTGTCAAGG
TCATCACCTTTGGCCTGAGCTTCCTCCTCCTCAAAGTCGCGACGGTTGGCGCCGACGAGAAGATCACGAATGCGATCTCGTACGGCATCCTTGCGCTGCA
GCTCGGCGTCCTCCTCTGCCTCCTCGCGCGGCAGATCTACATTTTCTACAAGACGCACCAGCTCAAGAAGGAGCTCGCGGCCTCCAACGACACGATGCGC
GGCGAAGACCTCTATGCGCTCGACGCGATCACGGCCCCCGGCGCGTATGCGATGGCGACCAACAGCACCAACCACCGCGACACGAGCCAGAAGCAGCGCG
AGTGGACGAGCGAGAGCCACCGCGCGAGCGACGACAAGCCGCGCTTTCCCCAGAAAACCAGCAACCACAATAACAACGGCAAGCTCAAAAACCTCAGCAA
CAACAACAACAACCAGCCGCACAATGGGCAGTGGAAGGAGGACGACTACGACCCGCGCGAGTACGCCATTTAA