Transcript Name :
Sappa_CBS223.65SPRG_00040
Orientation:
(-)
Number of Exons:
2
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4580.67129
InsideOutsideTMhelix
1-6
58-82
30-34
7-29
35-57
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        331 bases(100 bases per row)
ATGGCAAGCGTGCTCTCGATCCTCAAAGCCGCAAGTCTTATGCTCGTCGGCGCCATCCTTGCGTACGCATGAGATCTTATTGGGACCATGGCACCACGGT
AGTATGTGCTAGGTACAAGGCGATTGCGCTGGCGGCAGAGACCGTCGACCCGATCTTCTTCATCCCGCTCTTCGTTGTGCTCTTCGTCGTCGGCCTCGTC
CAGAGCCTCCCAGTGGCTGTGCACGCGATGCAAGACGCGTACAAGCCAGTGCCTGTCCGGCGGTCCGTCGTGCGCCTTCCGCCCTACCGCATCGTGTAGC
CATGTCTTAGCGCACTCTATTTATTTCCTGC